Transcript: Mouse XM_017321713.1

PREDICTED: Mus musculus charged multivesicular body protein 3 (Chmp3), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Chmp3 (66700)
Length:
3584
CDS:
1201..1797

Additional Resources:

NCBI RefSeq record:
XM_017321713.1
NBCI Gene record:
Chmp3 (66700)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017321713.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000382428 GAATGATGAGGACTCTATATT pLKO_005 2094 3UTR 100% 15.000 21.000 N Chmp3 n/a
2 TRCN0000098065 CGCCTGGATTTCTTCGTTGTT pLKO.1 3376 3UTR 100% 4.950 6.930 N Chmp3 n/a
3 TRCN0000381798 CACGATCTGCAGAGGATTTAA pLKO_005 1945 3UTR 100% 15.000 12.000 N Chmp3 n/a
4 TRCN0000098069 TGCCTCCAAAGCACACATGAA pLKO.1 1356 CDS 100% 4.950 3.960 N Chmp3 n/a
5 TRCN0000318201 TGCCTCCAAAGCACACATGAA pLKO_005 1356 CDS 100% 4.950 3.960 N Chmp3 n/a
6 TRCN0000382215 GAGTTGTTGACAGGCAAATAA pLKO_005 1205 CDS 100% 15.000 10.500 N CHMP3 n/a
7 TRCN0000098067 TCTTGTGAAGATCCCAGAAAT pLKO.1 1470 CDS 100% 13.200 9.240 N Chmp3 n/a
8 TRCN0000318284 TCTTGTGAAGATCCCAGAAAT pLKO_005 1470 CDS 100% 13.200 9.240 N Chmp3 n/a
9 TRCN0000098068 CCAAGGAGATGATCAGGTCAA pLKO.1 1313 CDS 100% 4.050 2.835 N Chmp3 n/a
10 TRCN0000318282 CCAAGGAGATGATCAGGTCAA pLKO_005 1313 CDS 100% 4.050 2.835 N Chmp3 n/a
11 TRCN0000141788 GAAGAGGGAGAAGAGGAAGAA pLKO.1 1723 CDS 100% 4.950 2.475 Y FAM9B n/a
12 TRCN0000088533 CGGGAGGCAGAGGCAGGCAAT pLKO.1 710 5UTR 100% 0.000 0.000 Y Trrap n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017321713.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03356 pDONR223 100% 79% 84.3% None (many diffs) n/a
2 ccsbBroad304_03356 pLX_304 0% 79% 84.3% V5 (many diffs) n/a
3 TRCN0000466056 GATTGTGGGACCCCCCCAGGACAG pLX_317 56.5% 79% 84.3% V5 (many diffs) n/a
Download CSV