Transcript: Mouse XM_011238772.2

PREDICTED: Mus musculus protoporphyrinogen oxidase (Ppox), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ppox (19044)
Length:
1844
CDS:
477..1778

Additional Resources:

NCBI RefSeq record:
XM_011238772.2
NBCI Gene record:
Ppox (19044)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011238772.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000319647 AGTGGATTGGCCGCAAGTTAT pLKO_005 365 5UTR 100% 13.200 10.560 N Ppox n/a
2 TRCN0000076761 CAGTCCTCCTAAGGTGATCTT pLKO.1 403 5UTR 100% 4.950 3.960 N Ppox n/a
3 TRCN0000319648 ACAAACCCACCGGTCCATATT pLKO_005 917 CDS 100% 13.200 9.240 N Ppox n/a
4 TRCN0000319581 AGTCTTTGCCGAGGAGTATTT pLKO_005 837 CDS 100% 13.200 9.240 N Ppox n/a
5 TRCN0000377082 CACAATCACCTAGCAAGTAAA pLKO_005 1065 CDS 100% 13.200 9.240 N Ppox n/a
6 TRCN0000076759 CAGCCGGATTCCTCACTAATT pLKO.1 972 CDS 100% 13.200 9.240 N Ppox n/a
7 TRCN0000317765 CAGCCGGATTCCTCACTAATT pLKO_005 972 CDS 100% 13.200 9.240 N Ppox n/a
8 TRCN0000076760 CCAGCCGGATTCCTCACTAAT pLKO.1 971 CDS 100% 13.200 9.240 N Ppox n/a
9 TRCN0000377148 GGACCTGAGGTGGCATCTTTA pLKO_005 807 CDS 100% 13.200 9.240 N Ppox n/a
10 TRCN0000076762 CCTGGTCCATCTACACAAGAA pLKO.1 1574 CDS 100% 4.950 3.465 N Ppox n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011238772.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01257 pDONR223 100% 76.3% 76.5% None (many diffs) n/a
2 ccsbBroad304_01257 pLX_304 0% 76.3% 76.5% V5 (many diffs) n/a
3 TRCN0000469068 ATATATTCTCGATTAGGTCAAACG pLX_317 33.7% 76.3% 76.5% V5 (many diffs) n/a
Download CSV