Transcript: Mouse XM_006506374.3

PREDICTED: Mus musculus heterogeneous nuclear ribonucleoprotein A2/B1 (Hnrnpa2b1), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Hnrnpa2b1 (53379)
Length:
2226
CDS:
640..1701

Additional Resources:

NCBI RefSeq record:
XM_006506374.3
NBCI Gene record:
Hnrnpa2b1 (53379)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006506374.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000071138 GTCACAATGCAGAAGTTAGAA pLKO.1 1175 CDS 100% 5.625 7.875 N Hnrnpa2b1 n/a
2 TRCN0000303121 GTCACAATGCAGAAGTTAGAA pLKO_005 1175 CDS 100% 5.625 7.875 N Hnrnpa2b1 n/a
3 TRCN0000071142 GCCTTCTAACTATGGTCCAAT pLKO.1 1566 CDS 100% 4.950 6.930 N Hnrnpa2b1 n/a
4 TRCN0000303025 GCCTTCTAACTATGGTCCAAT pLKO_005 1566 CDS 100% 4.950 6.930 N Hnrnpa2b1 n/a
5 TRCN0000071139 CGATAGGCAGTCTGGAAAGAA pLKO.1 1074 CDS 100% 5.625 3.938 N Hnrnpa2b1 n/a
6 TRCN0000303050 CGATAGGCAGTCTGGAAAGAA pLKO_005 1074 CDS 100% 5.625 3.938 N Hnrnpa2b1 n/a
7 TRCN0000001061 TGACAACTATGGAGGAGGAAA pLKO.1 1500 CDS 100% 4.950 3.465 N HNRNPA2B1 n/a
8 TRCN0000071141 CATTCCATTGATGGCAGGGTA pLKO.1 889 CDS 100% 2.640 1.848 N Hnrnpa2b1 n/a
9 TRCN0000303120 CATTCCATTGATGGCAGGGTA pLKO_005 889 CDS 100% 2.640 1.848 N Hnrnpa2b1 n/a
10 TRCN0000071140 GAGGAAATTATGGAAGTGGAA pLKO.1 1514 CDS 100% 2.640 1.848 N Hnrnpa2b1 n/a
11 TRCN0000001060 AGACAAGAAATGCAGGAAGTT pLKO.1 1207 CDS 100% 4.950 3.465 N HNRNPA2B1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006506374.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10887 pDONR223 100% 66.5% 43.8% None (many diffs) n/a
2 ccsbBroad304_10887 pLX_304 0% 66.5% 43.8% V5 (many diffs) n/a
3 TRCN0000474018 ACTCTAGCTTGTGTGCCCCAGACG pLX_317 17.6% 66.5% 43.8% V5 (many diffs) n/a
Download CSV