Transcript: Mouse XM_017317091.1

PREDICTED: Mus musculus zinc finger and BTB domain containing 20 (Zbtb20), transcript variant X27, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zbtb20 (56490)
Length:
26540
CDS:
469..2694

Additional Resources:

NCBI RefSeq record:
XM_017317091.1
NBCI Gene record:
Zbtb20 (56490)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017317091.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000086328 GCCTGCTGGTACATTACATTT pLKO.1 2873 3UTR 100% 13.200 18.480 N Zbtb20 n/a
2 TRCN0000312807 GGGCTACAGCGACATCGAAAT pLKO_005 873 CDS 100% 10.800 15.120 N Zbtb20 n/a
3 TRCN0000086330 CGGGTCATCTGATTGTGACAT pLKO.1 654 CDS 100% 4.950 6.930 N Zbtb20 n/a
4 TRCN0000086329 GCCCAGCAAAGTTTGACCAAA pLKO.1 2627 CDS 100% 4.950 3.960 N Zbtb20 n/a
5 TRCN0000312851 AGCTATGGCACTAGAATTTAA pLKO_005 2772 3UTR 100% 15.000 10.500 N Zbtb20 n/a
6 TRCN0000222178 CCCAGCAAAGTTTGACCAAAT pLKO.1 2628 CDS 100% 10.800 7.560 N ZBTB20 n/a
7 TRCN0000312848 TGTCAGTAACAGCTCCGATAA pLKO_005 1809 CDS 100% 10.800 7.560 N Zbtb20 n/a
8 TRCN0000086331 GCCTTCAGTCAACACATCCAT pLKO.1 1845 CDS 100% 3.000 2.100 N Zbtb20 n/a
9 TRCN0000311870 GCCTTCAGTCAACACATCCAT pLKO_005 1845 CDS 100% 3.000 2.100 N Zbtb20 n/a
10 TRCN0000086332 CAGATCCTAGAACGCAATGAA pLKO.1 1504 CDS 100% 5.625 3.375 N Zbtb20 n/a
11 TRCN0000311807 CAGATCCTAGAACGCAATGAA pLKO_005 1504 CDS 100% 5.625 3.375 N Zbtb20 n/a
12 TRCN0000166364 CACACACACACACACACACAA pLKO.1 23283 3UTR 100% 4.950 2.475 Y KAAG1 n/a
13 TRCN0000178741 CACACACATACACACACACAA pLKO.1 3089 3UTR 100% 4.950 2.475 Y Cstad n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017317091.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07993 pDONR223 100% 83.1% 87.9% None (many diffs) n/a
2 ccsbBroad304_07993 pLX_304 0% 83.1% 87.9% V5 (many diffs) n/a
3 TRCN0000476850 ACTACCACCCCAGAAATTGACATC pLX_317 19% 83.1% 87.9% V5 (many diffs) n/a
Download CSV