Transcript: Mouse XM_006534522.3

PREDICTED: Mus musculus ubiquitin-like domain containing CTD phosphatase 1 (Ublcp1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ublcp1 (79560)
Length:
3741
CDS:
1768..2724

Additional Resources:

NCBI RefSeq record:
XM_006534522.3
NBCI Gene record:
Ublcp1 (79560)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006534522.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000337851 TGATACTGTGCTGGATCTTAA pLKO_005 1833 CDS 100% 13.200 18.480 N Ublcp1 n/a
2 TRCN0000087731 CTCATTGACGTGAAGCCTCTT pLKO.1 2443 CDS 100% 4.050 5.670 N Ublcp1 n/a
3 TRCN0000087729 GCTCATCTAAACCGTGATAAA pLKO.1 2587 CDS 100% 13.200 10.560 N Ublcp1 n/a
4 TRCN0000087732 CCAGAAGTTACTAGGGCTCAA pLKO.1 1893 CDS 100% 4.050 3.240 N Ublcp1 n/a
5 TRCN0000337848 TCTTCCCTCTATGTTAATTTA pLKO_005 2893 3UTR 100% 15.000 10.500 N Ublcp1 n/a
6 TRCN0000337773 AGCACAAATGCCAACTATAAG pLKO_005 2365 CDS 100% 13.200 9.240 N Ublcp1 n/a
7 TRCN0000337775 AGCTCATCTAAACCGTGATAA pLKO_005 2586 CDS 100% 13.200 9.240 N Ublcp1 n/a
8 TRCN0000087730 GAGCACAAATGCCAACTATAA pLKO.1 2364 CDS 100% 13.200 9.240 N Ublcp1 n/a
9 TRCN0000087728 GCAGCAAACATCTAGCCATAA pLKO.1 3532 3UTR 100% 10.800 7.560 N Ublcp1 n/a
10 TRCN0000073182 GCTCTCAAACTGAAACCAAAT pLKO.1 1954 CDS 100% 10.800 7.560 N UBLCP1 n/a
11 TRCN0000337849 GTACTGGGAGAGGTATCTATC pLKO_005 2685 CDS 100% 10.800 7.560 N Ublcp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006534522.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14382 pDONR223 100% 88% 96.8% None (many diffs) n/a
2 ccsbBroad304_14382 pLX_304 0% 88% 96.8% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000468612 TTAACGTATTATTTTTGTATAGAA pLX_317 34.8% 88% 96.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV