Transcript: Mouse XM_006510395.3

PREDICTED: Mus musculus tubulin folding cofactor E-like (Tbcel), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tbcel (272589)
Length:
4836
CDS:
422..1321

Additional Resources:

NCBI RefSeq record:
XM_006510395.3
NBCI Gene record:
Tbcel (272589)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006510395.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251964 TATAGACGAGGACAGTTATTT pLKO_005 3113 3UTR 100% 15.000 21.000 N Tbcel n/a
2 TRCN0000216402 GTTTGTATGTACGATAATTTC pLKO.1 4479 3UTR 100% 13.200 18.480 N Tbcel n/a
3 TRCN0000149782 GAAGTGCCATTCAGGTATCAT pLKO.1 989 CDS 100% 5.625 4.500 N TBCEL n/a
4 TRCN0000251963 CAGGTATCATGAGCTCATTAC pLKO_005 1000 CDS 100% 10.800 7.560 N Tbcel n/a
5 TRCN0000257562 CGTGTCAGAACTCGATCTTTC pLKO_005 453 CDS 100% 10.800 7.560 N Tbcel n/a
6 TRCN0000251962 TCCTCTTCTACAGCCGTATAC pLKO_005 832 CDS 100% 10.800 7.560 N Tbcel n/a
7 TRCN0000189858 GCCGAACTGAAGAAACAGCTA pLKO.1 1142 CDS 100% 2.640 1.848 N Tbcel n/a
8 TRCN0000257567 GCATGCTTCTCTACTACTTTG pLKO_005 1191 CDS 100% 10.800 6.480 N Tbcel n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006510395.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05234 pDONR223 100% 62.5% 65.3% None (many diffs) n/a
2 ccsbBroad304_05234 pLX_304 0% 62.5% 65.3% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000468699 GACGATCCAATCGCGACGTGTACT pLX_317 38.1% 62.5% 65.3% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV