Transcript: Mouse XM_017315203.1

PREDICTED: Mus musculus cyclin-dependent kinase-like 1 (CDC2-related kinase) (Cdkl1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cdkl1 (71091)
Length:
1855
CDS:
340..1398

Additional Resources:

NCBI RefSeq record:
XM_017315203.1
NBCI Gene record:
Cdkl1 (71091)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017315203.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000023211 CCACTGTAGTACCAAGAGATT pLKO.1 1353 CDS 100% 4.950 6.930 N Cdkl1 n/a
2 TRCN0000361791 GCTGTTGCAGCATCCATATTT pLKO_005 1179 CDS 100% 15.000 10.500 N Cdkl1 n/a
3 TRCN0000361792 CCCAGGCACCAGCAAGTATTT pLKO_005 1006 CDS 100% 13.200 9.240 N Cdkl1 n/a
4 TRCN0000361850 CTGCCCACAGCTACAACATTA pLKO_005 1659 3UTR 100% 13.200 9.240 N Cdkl1 n/a
5 TRCN0000361790 GTGATGAAGAATTGATCAATA pLKO_005 1411 3UTR 100% 13.200 9.240 N Cdkl1 n/a
6 TRCN0000023210 CCTGTAGATGTCTGGGCAATT pLKO.1 883 CDS 100% 10.800 7.560 N Cdkl1 n/a
7 TRCN0000023209 CCAAGAGATTTAACTACCATT pLKO.1 1364 CDS 100% 4.950 3.465 N Cdkl1 n/a
8 TRCN0000023212 TGCCATAAACATAACTGCATA pLKO.1 688 CDS 100% 4.950 3.465 N Cdkl1 n/a
9 TRCN0000023213 GCCATCAAGAGGTTTCTGGAA pLKO.1 430 CDS 100% 2.640 1.848 N Cdkl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017315203.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02021 pDONR223 100% 84.4% 88.5% None (many diffs) n/a
2 ccsbBroad304_02021 pLX_304 0% 84.4% 88.5% V5 (many diffs) n/a
3 TRCN0000477527 TGTAACCGATCCCACACATCGTGG pLX_317 34.4% 84.4% 88.5% V5 (many diffs) n/a
4 TRCN0000470267 AATACCCGCGTAGATCGAACGGGA pLX_317 41.7% 73.3% 78.1% V5 (many diffs) n/a
5 ccsbBroadEn_14914 pDONR223 100% 73.2% 77.9% None (many diffs) n/a
6 ccsbBroad304_14914 pLX_304 0% 73.2% 77.9% V5 (many diffs) n/a
Download CSV