Transcript: Mouse XM_006516333.2

PREDICTED: Mus musculus zinc finger CCCH type containing 14 (Zc3h14), transcript variant X10, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zc3h14 (75553)
Length:
2620
CDS:
1031..2353

Additional Resources:

NCBI RefSeq record:
XM_006516333.2
NBCI Gene record:
Zc3h14 (75553)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006516333.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000175101 GAGATGAGTCAAGATTACTAT pLKO.1 1487 CDS 100% 5.625 4.500 N Zc3h14 n/a
2 TRCN0000341192 GAGATGAGTCAAGATTACTAT pLKO_005 1487 CDS 100% 5.625 4.500 N Zc3h14 n/a
3 TRCN0000128105 CCGTTACTTCCCTGCTTGTAA pLKO.1 2188 CDS 100% 5.625 3.938 N ZC3H14 n/a
4 TRCN0000343697 CCGTTACTTCCCTGCTTGTAA pLKO_005 2188 CDS 100% 5.625 3.938 N ZC3H14 n/a
5 TRCN0000128765 CCAGGATACATGTCAGATCAA pLKO.1 1730 CDS 100% 4.950 3.465 N ZC3H14 n/a
6 TRCN0000173125 CACCTTATGCAGACACGAGAT pLKO.1 1643 CDS 100% 4.050 2.835 N Zc3h14 n/a
7 TRCN0000341193 CACCTTATGCAGACACGAGAT pLKO_005 1643 CDS 100% 4.050 2.835 N Zc3h14 n/a
8 TRCN0000176300 CGACTGCAAATTGATCCAGTA pLKO.1 1451 CDS 100% 4.050 2.835 N Zc3h14 n/a
9 TRCN0000129229 CCATGCAGACACAAGATCATT pLKO.1 1525 CDS 100% 5.625 3.375 N ZC3H14 n/a
10 TRCN0000343635 CCATGCAGACACAAGATCATT pLKO_005 1525 CDS 100% 5.625 3.375 N ZC3H14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006516333.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04145 pDONR223 100% 61.3% 58.6% None (many diffs) n/a
2 ccsbBroad304_04145 pLX_304 0% 61.3% 58.6% V5 (many diffs) n/a
3 TRCN0000470306 CTTTCGGACTTCGTTGACTCCACG pLX_317 55.1% 61.3% 58.6% V5 (many diffs) n/a
Download CSV