Transcript: Mouse XM_006521795.3

PREDICTED: Mus musculus glutamate receptor, ionotropic, NMDA2A (epsilon 1) (Grin2a), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Grin2a (14811)
Length:
7300
CDS:
520..2694

Additional Resources:

NCBI RefSeq record:
XM_006521795.3
NBCI Gene record:
Grin2a (14811)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006521795.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000100267 GCACCAGTACATGACCAAATT pLKO.1 2622 CDS 100% 13.200 9.240 N Grin2a n/a
2 TRCN0000100268 CGGCTACGATTTCTTCTGGAT pLKO.1 1266 CDS 100% 2.640 1.848 N Grin2a n/a
3 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3367 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006521795.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00691 pDONR223 100% 50.2% 54.8% None (many diffs) n/a
2 ccsbBroad304_00691 pLX_304 0% 50.2% 54.8% V5 (many diffs) n/a
3 TRCN0000468211 CCTTCACAAATCATTCCAAACCGG pLX_317 11.7% 50.2% 54.8% V5 (many diffs) n/a
4 TRCN0000492327 TAGTGGACTAGGTAGTCAATGGTC pLX_317 9.5% 43.9% 48% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV