Transcript: Mouse XR_001780818.1

PREDICTED: Mus musculus excision repaiross-complementing rodent repair deficiency, complementation group 8 (Ercc8), transcript variant X5, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ercc8 (71991)
Length:
1027
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001780818.1
NBCI Gene record:
Ercc8 (71991)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001780818.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000249433 GGGTTAACACCCTCGACATTG pLKO_005 216 3UTR 100% 10.800 15.120 N Ercc8 n/a
2 TRCN0000217072 CACATCCAGCTCATTTGATAA pLKO.1 427 3UTR 100% 13.200 9.240 N Ercc8 n/a
3 TRCN0000175788 GAGTTAAACAAAGACAGGGAT pLKO.1 173 3UTR 100% 2.640 1.848 N Ercc8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001780818.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10735 pDONR223 100% 50% None (many diffs) n/a
2 ccsbBroad304_10735 pLX_304 0% 50% V5 (many diffs) n/a
3 TRCN0000470233 TGCAGCCACTTTTTTAGGCACCTT pLX_317 73% 50% V5 (many diffs) n/a
Download CSV