Transcript: Mouse XM_006497672.3

PREDICTED: Mus musculus WD repeat domain 5 (Wdr5), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Wdr5 (140858)
Length:
3213
CDS:
531..1535

Additional Resources:

NCBI RefSeq record:
XM_006497672.3
NBCI Gene record:
Wdr5 (140858)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006497672.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000304471 TTGATAGCCACTGTGATATTT pLKO_005 1683 3UTR 100% 15.000 21.000 N Wdr5 n/a
2 TRCN0000034414 CGTGCATAATAAGAATCCAAA pLKO.1 2815 3UTR 100% 4.950 3.960 N Wdr5 n/a
3 TRCN0000304472 CAAGTTCATCTGCTGATAAAC pLKO_005 712 CDS 100% 13.200 9.240 N Wdr5 n/a
4 TRCN0000034418 CTTCGTGAAGTTCTCTCCAAA pLKO.1 1184 CDS 100% 4.950 3.465 N Wdr5 n/a
5 TRCN0000034415 GCAGCGTTAGAGAACGACAAA pLKO.1 1485 CDS 100% 4.950 3.465 N Wdr5 n/a
6 TRCN0000301680 GCAGCGTTAGAGAACGACAAA pLKO_005 1485 CDS 100% 4.950 3.465 N Wdr5 n/a
7 TRCN0000034417 GCCAAACTATGCCCTGAAGTT pLKO.1 626 CDS 100% 4.950 3.465 N Wdr5 n/a
8 TRCN0000301601 GCCAAACTATGCCCTGAAGTT pLKO_005 626 CDS 100% 4.950 3.465 N Wdr5 n/a
9 TRCN0000034416 GCCGTTCATTTCAACCGTGAT pLKO.1 1056 CDS 100% 4.050 2.835 N Wdr5 n/a
10 TRCN0000301679 GCCGTTCATTTCAACCGTGAT pLKO_005 1056 CDS 100% 4.050 2.835 N Wdr5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006497672.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07746 pDONR223 100% 87.6% 100% None (many diffs) n/a
2 ccsbBroad304_07746 pLX_304 0% 87.6% 100% V5 (many diffs) n/a
3 TRCN0000468790 TTAAATAGCTGAGCCATTCAATTC pLX_317 40.9% 87.6% 100% V5 (many diffs) n/a
Download CSV