Transcript: Mouse XM_006511546.2

PREDICTED: Mus musculus CUGBP, Elav-like family member 6 (Celf6), transcript variant X8, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Celf6 (76183)
Length:
4352
CDS:
233..1270

Additional Resources:

NCBI RefSeq record:
XM_006511546.2
NBCI Gene record:
Celf6 (76183)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006511546.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000098640 CCACCCTTTAAGAATATGATA pLKO.1 1814 3UTR 100% 5.625 7.875 N Celf6 n/a
2 TRCN0000098641 GCCTTTGTGAAATTCGGAAGT pLKO.1 416 CDS 100% 4.050 3.240 N Celf6 n/a
3 TRCN0000412680 AGACAGTATAGAGTCTCATAA pLKO_005 1671 3UTR 100% 13.200 9.240 N CELF6 n/a
4 TRCN0000098643 CCTTCAGCTCTGCCTCAACAA pLKO.1 968 CDS 100% 4.950 3.465 N Celf6 n/a
5 TRCN0000098644 AGTCAATGGATTCGGCTCCTT pLKO.1 829 CDS 100% 2.640 1.848 N Celf6 n/a
6 TRCN0000074449 CATACAGACATTCCTGCCCTT pLKO.1 1060 CDS 100% 2.160 1.512 N CELF6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006511546.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15129 pDONR223 86.6% 79.7% 85.1% None (many diffs) n/a
2 ccsbBroad304_15129 pLX_304 0% 79.7% 85.1% V5 (many diffs) n/a
3 TRCN0000465220 ATAAAGCACCCGCTCCGACAGGGA pLX_317 17.5% 79.7% 85.1% V5 (many diffs) n/a
Download CSV