Transcript: Mouse XR_001785570.1

PREDICTED: Mus musculus protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 4 (Ppfia4), transcript variant X9, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ppfia4 (68507)
Length:
7329
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001785570.1
NBCI Gene record:
Ppfia4 (68507)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001785570.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000376341 TGAGATGACCCTTCCAATAAA pLKO_005 5699 3UTR 100% 15.000 21.000 N Ppfia4 n/a
2 TRCN0000342144 CAGGTCTGCATCGACGCTATT pLKO_005 2081 3UTR 100% 10.800 15.120 N Ppfia4 n/a
3 TRCN0000342142 CACCCAGGTTGTAGGTGTTTG pLKO_005 5568 3UTR 100% 10.800 8.640 N Ppfia4 n/a
4 TRCN0000376282 TGTCTGAAGAGGCTGAATTAT pLKO_005 4788 3UTR 100% 15.000 10.500 N Ppfia4 n/a
5 TRCN0000352662 AGGCCCTCAAGTCACTATTTG pLKO_005 1025 3UTR 100% 13.200 9.240 N Ppfia4 n/a
6 TRCN0000342143 GCTGAAAGCAGAGCGGAATAA pLKO_005 879 3UTR 100% 13.200 9.240 N Ppfia4 n/a
7 TRCN0000376354 CTATAGGGCTAAGGGACTATG pLKO_005 4906 3UTR 100% 10.800 7.560 N Ppfia4 n/a
8 TRCN0000052694 GCATGAGATCAAGGATGTGTT pLKO.1 4847 3UTR 100% 4.950 3.465 N PPFIA4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001785570.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07247 pDONR223 100% 25.9% None (many diffs) n/a
2 ccsbBroad304_07247 pLX_304 0% 25.9% V5 (many diffs) n/a
3 TRCN0000480685 TCGATCTTAAGAGGCCGGTGGTAA pLX_317 15.8% 25.9% V5 (many diffs) n/a
Download CSV