Transcript: Mouse XM_006512301.3

PREDICTED: Mus musculus DEAH (Asp-Glu-Ala-His) box polypeptide 30 (Dhx30), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dhx30 (72831)
Length:
4149
CDS:
423..4076

Additional Resources:

NCBI RefSeq record:
XM_006512301.3
NBCI Gene record:
Dhx30 (72831)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006512301.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000113045 GCTGCATAAGTCAACCATTAA pLKO.1 3659 CDS 100% 13.200 18.480 N Dhx30 n/a
2 TRCN0000316975 GCTGCATAAGTCAACCATTAA pLKO_005 3659 CDS 100% 13.200 18.480 N Dhx30 n/a
3 TRCN0000113048 GACATATTTCATGGCCGTCAA pLKO.1 3713 CDS 100% 4.050 5.670 N Dhx30 n/a
4 TRCN0000316974 GACATATTTCATGGCCGTCAA pLKO_005 3713 CDS 100% 4.050 5.670 N Dhx30 n/a
5 TRCN0000113046 CCACGGAATGAGCTGTTTGAT pLKO.1 876 CDS 100% 5.625 3.938 N Dhx30 n/a
6 TRCN0000316995 CCACGGAATGAGCTGTTTGAT pLKO_005 876 CDS 100% 5.625 3.938 N Dhx30 n/a
7 TRCN0000113049 CCTCTTAGTGTGCAGCAAGAA pLKO.1 3972 CDS 100% 4.950 3.465 N Dhx30 n/a
8 TRCN0000316976 CCTCTTAGTGTGCAGCAAGAA pLKO_005 3972 CDS 100% 4.950 3.465 N Dhx30 n/a
9 TRCN0000113047 CCTTGGCATCTCACATGCAAA pLKO.1 683 CDS 100% 4.950 3.465 N Dhx30 n/a
10 TRCN0000316915 CCTTGGCATCTCACATGCAAA pLKO_005 683 CDS 100% 4.950 3.465 N Dhx30 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006512301.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11646 pDONR223 100% 36.5% 40.3% None (many diffs) n/a
2 ccsbBroad304_11646 pLX_304 0% 36.5% 40.3% V5 (many diffs) n/a
3 TRCN0000466080 AAATGAGCCCAAAGCTAGAACCAC pLX_317 26.3% 36.5% 40.3% V5 (many diffs) n/a
Download CSV