Transcript: Mouse NM_001347598.1

Mus musculus homer scaffolding protein 1 (Homer1), transcript variant M, mRNA.

Source:
NCBI, updated 2017-06-16
Taxon:
Mus musculus (mouse)
Gene:
Homer1 (26556)
Length:
3129
CDS:
1542..2153

Additional Resources:

NCBI RefSeq record:
NM_001347598.1
NBCI Gene record:
Homer1 (26556)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001347598.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000220011 GTGTATAGGATAATCAGTTTA pLKO.1 1671 CDS 100% 13.200 18.480 N HOMER1 n/a
2 TRCN0000332915 GTGTATAGGATAATCAGTTTA pLKO_005 1671 CDS 100% 13.200 18.480 N HOMER1 n/a
3 TRCN0000434804 GTGTATAGGATAATCAGTTTA pLKO_005 1671 CDS 100% 13.200 18.480 N Homer1 n/a
4 TRCN0000106572 GCATGCAGTTACTGTATCTTA pLKO.1 1628 CDS 100% 5.625 4.500 N Homer1 n/a
5 TRCN0000106574 TGACCCGAACACAAAGAAGAA pLKO.1 1589 CDS 100% 4.950 3.465 N Homer1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001347598.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02169 pDONR223 100% 50.3% 50.4% None (many diffs) n/a
2 ccsbBroad304_02169 pLX_304 0% 50.3% 50.4% V5 (many diffs) n/a
3 TRCN0000469856 ATACTATTTCAACTCCACATACCG pLX_317 45% 50.3% 50.4% V5 (many diffs) n/a
4 TRCN0000488415 CCTTCGGACTAAATACTAGACATG pLX_317 29.2% 50.3% 50.4% V5 (many diffs) n/a
5 TRCN0000489063 AGCGGGTCAATTATGCTTTGTAAA pLX_317 35.8% 50.3% 50.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV