Transcript: Human NM_004816.4

Homo sapiens family with sequence similarity 189 member A2 (FAM189A2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
FAM189A2 (9413)
Length:
2454
CDS:
421..1773

Additional Resources:

NCBI RefSeq record:
NM_004816.4
NBCI Gene record:
FAM189A2 (9413)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004816.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000275872 ACCGCGGTCTTTGATAGATTA pLKO_005 1383 CDS 100% 13.200 18.480 N FAM189A2 n/a
2 TRCN0000130658 CCTAACATACCTGCCGAAGAA pLKO.1 1135 CDS 100% 4.950 6.930 N FAM189A2 n/a
3 TRCN0000127971 GCCTTGAAACTCTTTCCGGTT pLKO.1 619 CDS 100% 2.160 3.024 N FAM189A2 n/a
4 TRCN0000275871 GCCTTGAAACTCTTTCCGGTT pLKO_005 619 CDS 100% 2.160 3.024 N FAM189A2 n/a
5 TRCN0000128646 CCTCTTAAATCTAGCTGGATT pLKO.1 468 CDS 100% 4.950 3.960 N FAM189A2 n/a
6 TRCN0000127807 GCTCGAATCAAAGGTGTGGAA pLKO.1 958 CDS 100% 2.640 2.112 N FAM189A2 n/a
7 TRCN0000275873 CTCCGCTACCTCCAGATATTC pLKO_005 739 CDS 100% 13.200 9.240 N FAM189A2 n/a
8 TRCN0000127904 CTCTGCGATTTGGCAGGAAAT pLKO.1 2191 3UTR 100% 10.800 7.560 N FAM189A2 n/a
9 TRCN0000275874 CTCTGCGATTTGGCAGGAAAT pLKO_005 2191 3UTR 100% 10.800 7.560 N FAM189A2 n/a
10 TRCN0000275870 GAGATCCTGCATCGATGAATC pLKO_005 768 CDS 100% 10.800 7.560 N FAM189A2 n/a
11 TRCN0000129172 CCCTCAAATCACACTCTCTTT pLKO.1 2262 3UTR 100% 4.950 3.465 N FAM189A2 n/a
12 TRCN0000129124 GAAATCTGATGAGGAGCACAT pLKO.1 1512 CDS 100% 4.050 2.835 N FAM189A2 n/a
13 TRCN0000130756 GAAGTGTTCTGTCCTCTGGAT pLKO.1 976 CDS 100% 2.640 1.848 N FAM189A2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004816.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02158 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02158 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000478928 TACTGTGACCAATTTTTATACCCA pLX_317 31.9% 100% 100% V5 n/a
Download CSV