Transcript: Human NM_001348096.1

Homo sapiens GDNF family receptor alpha 1 (GFRA1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
GFRA1 (2674)
Length:
9244
CDS:
389..1771

Additional Resources:

NCBI RefSeq record:
NM_001348096.1
NBCI Gene record:
GFRA1 (2674)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001348096.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000060629 CCAACTACATAGACTCCAGTA pLKO.1 1269 CDS 100% 4.050 5.670 N GFRA1 n/a
2 TRCN0000060632 CGACGACATTTGCAAGAAGTA pLKO.1 862 CDS 100% 4.950 3.960 N GFRA1 n/a
3 TRCN0000060631 GCAGGGTCTGAGAATGAAATT pLKO.1 1514 CDS 100% 13.200 9.240 N GFRA1 n/a
4 TRCN0000060628 CCTCTGTATTTCCAATGGTAA pLKO.1 1609 CDS 100% 4.950 3.465 N GFRA1 n/a
5 TRCN0000060630 GCGCATTTACTGGAGCATGTA pLKO.1 688 CDS 100% 4.950 3.465 N GFRA1 n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 8159 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001348096.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000468740 CACCCGGGCCTTACATTGGCTGAT pLX_317 16.2% 99.9% 100% V5 537C>T n/a
2 ccsbBroadEn_06270 pDONR223 100% 99.8% 99.7% None 537C>T;1364C>N n/a
3 ccsbBroad304_06270 pLX_304 0% 99.8% 99.7% V5 537C>T;1364C>N n/a
Download CSV