Transcript: Human NM_001349801.2

Homo sapiens DEAD-box helicase 59 (DDX59), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-01-13
Taxon:
Homo sapiens (human)
Gene:
DDX59 (83479)
Length:
2191
CDS:
244..1974

Additional Resources:

NCBI RefSeq record:
NM_001349801.2
NBCI Gene record:
DDX59 (83479)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001349801.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000370215 GCGATTACTTTCATCAATAAT pLKO_005 1747 CDS 100% 15.000 21.000 N DDX59 n/a
2 TRCN0000236413 TGGGCGACTTCTGGATATAAT pLKO_005 1233 CDS 100% 15.000 21.000 N DDX59 n/a
3 TRCN0000050912 CCTGTTATCATGCGAGCTTTA pLKO.1 1021 CDS 100% 10.800 15.120 N DDX59 n/a
4 TRCN0000050911 CCACAGCTTTATCGTCTGCAA pLKO.1 1183 CDS 100% 2.640 3.696 N DDX59 n/a
5 TRCN0000050909 GCGAGCTTTATTCGAGAGCAA pLKO.1 1032 CDS 100% 2.640 3.696 N DDX59 n/a
6 TRCN0000236414 GTGCCAATGTACGTCAGATTA pLKO_005 1484 CDS 100% 13.200 10.560 N DDX59 n/a
7 TRCN0000370216 GAGCTAATCTTATGGATATTA pLKO_005 1919 CDS 100% 15.000 10.500 N DDX59 n/a
8 TRCN0000236411 TGTTATCATGCGAGCTTTATT pLKO_005 1023 CDS 100% 15.000 10.500 N DDX59 n/a
9 TRCN0000255354 TTCTCTGCCACTTGAATATTT pLKO_005 1977 3UTR 100% 15.000 10.500 N DDX59 n/a
10 TRCN0000236410 TAGTCTCCCTGAGGTCTTAAA pLKO_005 867 CDS 100% 13.200 9.240 N DDX59 n/a
11 TRCN0000050908 CCCATTCAAATGCAGATGATT pLKO.1 925 CDS 100% 5.625 3.938 N DDX59 n/a
12 TRCN0000377527 CATAAATGGAAATGTACATGA pLKO_005 2036 3UTR 100% 4.950 3.465 N DDX59 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001349801.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09099 pDONR223 100% 92.9% 92.8% None 663A>G;1416C>A;1465_1466ins129 n/a
2 ccsbBroad304_09099 pLX_304 0% 92.9% 92.8% V5 663A>G;1416C>A;1465_1466ins129 n/a
3 TRCN0000478444 TGAAAACAAATATATACCATCATC pLX_317 20.2% 92.9% 92.8% V5 663A>G;1416C>A;1465_1466ins129 n/a
Download CSV