Transcript: Human NM_001350735.1

Homo sapiens thioredoxin domain containing 15 (TXNDC15), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-02
Taxon:
Homo sapiens (human)
Gene:
TXNDC15 (79770)
Length:
3642
CDS:
816..1694

Additional Resources:

NCBI RefSeq record:
NM_001350735.1
NBCI Gene record:
TXNDC15 (79770)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001350735.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000064308 GCCAGATTTAATCATACAGAT pLKO.1 1434 CDS 100% 4.950 6.930 N TXNDC15 n/a
2 TRCN0000064311 GCCGACCAAATAGGCCCTCTT pLKO.1 1533 CDS 100% 1.350 1.890 N TXNDC15 n/a
3 TRCN0000296278 CCCGACAGAGGACTCCAATAA pLKO_005 1088 CDS 100% 13.200 10.560 N TXNDC15 n/a
4 TRCN0000296280 TGAAACTTCAGGCAGATTAAA pLKO_005 1791 3UTR 100% 15.000 10.500 N TXNDC15 n/a
5 TRCN0000064309 GCACCGTAGCTGTTCCTAATA pLKO.1 1384 CDS 100% 13.200 9.240 N TXNDC15 n/a
6 TRCN0000289657 GCACCGTAGCTGTTCCTAATA pLKO_005 1384 CDS 100% 13.200 9.240 N TXNDC15 n/a
7 TRCN0000064310 CAGAGGAAAGTGGTCGCTTAT pLKO.1 718 5UTR 100% 10.800 7.560 N TXNDC15 n/a
8 TRCN0000064312 GAGAGAAACATTACAGGATTA pLKO.1 1146 CDS 100% 10.800 7.560 N TXNDC15 n/a
9 TRCN0000296279 TGACAGAGAAGAGGAGTATTA pLKO_005 1034 CDS 100% 13.200 7.920 N TXNDC15 n/a
10 TRCN0000008902 CCTCCCAAAGTGTTGGGATTA pLKO.1 3051 3UTR 100% 1.080 0.540 Y GPR83 n/a
11 TRCN0000156315 CCTCCCAAAGTGTTGGGATTA pLKO.1 3051 3UTR 100% 1.080 0.540 Y MYORG n/a
12 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2420 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001350735.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08956 pDONR223 100% 81.1% 81.1% None 0_1ins204 n/a
2 ccsbBroad304_08956 pLX_304 0% 81.1% 81.1% V5 0_1ins204 n/a
3 TRCN0000467636 TCGGCGGAATAACCCAAGGCACAA pLX_317 29% 81.1% 81.1% V5 0_1ins204 n/a
Download CSV