Transcript: Human NM_025106.4

Homo sapiens splA/ryanodine receptor domain and SOCS box containing 1 (SPSB1), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
SPSB1 (80176)
Length:
3106
CDS:
328..1149

Additional Resources:

NCBI RefSeq record:
NM_025106.4
NBCI Gene record:
SPSB1 (80176)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_025106.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116166 TGAGATCCGAATGCGCTACTT pLKO.1 987 CDS 100% 4.950 6.930 N SPSB1 n/a
2 TRCN0000288935 TGAGATCCGAATGCGCTACTT pLKO_005 987 CDS 100% 4.950 6.930 N SPSB1 n/a
3 TRCN0000116165 CGCTACTTGAACGGACTCGAT pLKO.1 1000 CDS 100% 2.640 3.696 N SPSB1 n/a
4 TRCN0000288933 CGCTACTTGAACGGACTCGAT pLKO_005 1000 CDS 100% 2.640 3.696 N SPSB1 n/a
5 TRCN0000116162 CGTACCCTGTATTTATTCTTT pLKO.1 1744 3UTR 100% 5.625 4.500 N SPSB1 n/a
6 TRCN0000288936 CGTACCCTGTATTTATTCTTT pLKO_005 1744 3UTR 100% 5.625 4.500 N SPSB1 n/a
7 TRCN0000116164 GAACCAGATGAGACATTCATT pLKO.1 823 CDS 100% 5.625 3.938 N SPSB1 n/a
8 TRCN0000288932 GAACCAGATGAGACATTCATT pLKO_005 823 CDS 100% 5.625 3.938 N SPSB1 n/a
9 TRCN0000116163 GCTGCATTCATGGAACAACAA pLKO.1 483 CDS 100% 4.950 3.465 N SPSB1 n/a
10 TRCN0000288934 GCTGCATTCATGGAACAACAA pLKO_005 483 CDS 100% 4.950 3.465 N SPSB1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025106.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09009 pDONR223 100% 99.7% 99.2% None 4G>T;14T>G n/a
2 ccsbBroad304_09009 pLX_304 0% 99.7% 99.2% V5 4G>T;14T>G n/a
3 TRCN0000481173 CTCTACCGGTGATGCGTCAGTCGT pLX_317 59.7% 99.7% 99.2% V5 4G>T;14T>G n/a
Download CSV