Transcript: Human XM_017003749.2

PREDICTED: Homo sapiens ceramide synthase 6 (CERS6), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CERS6 (253782)
Length:
6527
CDS:
780..1535

Additional Resources:

NCBI RefSeq record:
XM_017003749.2
NBCI Gene record:
CERS6 (253782)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017003749.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000344344 ACCACACGACTGGGTATATTT pLKO_005 1173 CDS 100% 15.000 21.000 N CERS6 n/a
2 TRCN0000129261 CGGACGAACTAGGTGTTTAAT pLKO.1 2061 3UTR 100% 15.000 21.000 N CERS6 n/a
3 TRCN0000344264 ACTGACCTTCACTACTATTAC pLKO_005 882 CDS 100% 13.200 9.240 N CERS6 n/a
4 TRCN0000344345 CCCAAGCAAAGTGAACTATTT pLKO_005 1554 3UTR 100% 13.200 9.240 N CERS6 n/a
5 TRCN0000128836 GAACTGCTTCTGGTCTTACTT pLKO.1 1298 CDS 100% 5.625 3.938 N CERS6 n/a
6 TRCN0000344342 GAACTGCTTCTGGTCTTACTT pLKO_005 1298 CDS 100% 5.625 3.938 N CERS6 n/a
7 TRCN0000128857 GCTATTGCTAGTACAAGGGTT pLKO.1 1277 CDS 100% 2.640 1.848 N CERS6 n/a
8 TRCN0000128728 CCTGTTTGTTATGTTTGCCGT pLKO.1 1142 CDS 100% 0.660 0.462 N CERS6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017003749.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13453 pDONR223 100% 63.1% 61.3% None (many diffs) n/a
2 ccsbBroad304_13453 pLX_304 0% 63.1% 61.3% V5 (many diffs) n/a
3 TRCN0000472754 TGAAGACCTGGACACGGGATGATG pLX_317 38.1% 63.1% 61.3% V5 (many diffs) n/a
Download CSV