Transcript: Human NM_001363099.2

Homo sapiens zinc finger protein 250 (ZNF250), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
ZNF250 (58500)
Length:
6726
CDS:
484..2166

Additional Resources:

NCBI RefSeq record:
NM_001363099.2
NBCI Gene record:
ZNF250 (58500)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001363099.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244353 TTGAGTCCGAAGCCATTAATT pLKO_005 880 CDS 100% 15.000 21.000 N ZNF250 n/a
2 TRCN0000017846 GACTACTCAGACAACCTCAAA pLKO.1 772 CDS 100% 4.950 6.930 N ZNF250 n/a
3 TRCN0000244352 TACTCAGACAACCTCAAATAT pLKO_005 775 CDS 100% 15.000 10.500 N ZNF250 n/a
4 TRCN0000244351 CCGTGAAGTTCAGGTCTTAAG pLKO_005 1005 CDS 100% 10.800 7.560 N ZNF250 n/a
5 TRCN0000017844 CACCGTGAAGTTCAGGTCTTA pLKO.1 1003 CDS 100% 4.950 3.465 N ZNF250 n/a
6 TRCN0000017845 CAGCCTGAAAGCAACTCTGAT pLKO.1 1947 CDS 100% 4.950 3.465 N ZNF250 n/a
7 TRCN0000017843 CCTATGGGAATGTAGTCTCAT pLKO.1 644 CDS 100% 4.950 3.465 N ZNF250 n/a
8 TRCN0000244328 CAGTATCCATTGCCATATTAC pLKO_005 3503 3UTR 100% 13.200 7.920 N ZNF250 n/a
9 TRCN0000017847 CTTGCTCAGCATCACAAGATA pLKO.1 1291 CDS 100% 5.625 3.375 N ZNF250 n/a
10 TRCN0000116737 CCTCCCAAGTAGCTGGAATTA pLKO.1 3717 3UTR 100% 13.200 6.600 Y CLDN18 n/a
11 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 6327 3UTR 100% 4.950 2.475 Y CFLAR n/a
12 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 6327 3UTR 100% 4.950 2.475 Y C19orf31 n/a
13 TRCN0000155187 GAGATGAGGTTTCACCATGTT pLKO.1 3782 3UTR 100% 4.950 2.475 Y GTF2IRD2B n/a
14 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3855 3UTR 100% 5.625 2.813 Y KLHL30 n/a
15 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 6325 3UTR 100% 4.950 2.475 Y ERN2 n/a
16 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 6325 3UTR 100% 4.950 2.475 Y P3H4 n/a
17 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 6325 3UTR 100% 4.950 2.475 Y P3H4 n/a
18 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3855 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001363099.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12415 pDONR223 100% 91% 91% None 1_150del n/a
2 ccsbBroad304_12415 pLX_304 0% 91% 91% V5 1_150del n/a
3 TRCN0000481370 TGAACCCTTGAATGACGCTTCCCC pLX_317 31% 91% 91% V5 1_150del n/a
Download CSV