Transcript: Human NM_016369.4

Homo sapiens claudin 18 (CLDN18), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
CLDN18 (51208)
Length:
3355
CDS:
62..847

Additional Resources:

NCBI RefSeq record:
NM_016369.4
NBCI Gene record:
CLDN18 (51208)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_016369.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429247 CCTCCGGGATCATGTTCATTG pLKO_005 420 CDS 100% 10.800 15.120 N CLDN18 n/a
2 TRCN0000116741 CTGGATGTCCACAGCTAACAT pLKO.1 502 CDS 100% 5.625 7.875 N CLDN18 n/a
3 TRCN0000116738 CCAACTACAAAGCCGTTTCTT pLKO.1 672 CDS 100% 5.625 4.500 N CLDN18 n/a
4 TRCN0000116739 GAGGACGAGGTACAATCTTAT pLKO.1 803 CDS 100% 13.200 9.240 N CLDN18 n/a
5 TRCN0000417578 TAAACCCATTGATGATCTATT pLKO_005 1194 3UTR 100% 13.200 9.240 N CLDN18 n/a
6 TRCN0000417611 TAGAGGCTATAGCTCACATTT pLKO_005 1056 3UTR 100% 13.200 9.240 N CLDN18 n/a
7 TRCN0000116740 GCCCTGAAATGCATCCGCATT pLKO.1 359 CDS 100% 0.405 0.284 N CLDN18 n/a
8 TRCN0000116737 CCTCCCAAGTAGCTGGAATTA pLKO.1 2404 3UTR 100% 13.200 6.600 Y CLDN18 n/a
9 TRCN0000138391 CGCCTGTAATCCTAGCACTTT pLKO.1 1863 3UTR 100% 4.950 2.475 Y DENND6A n/a
10 TRCN0000175984 GATTTCATCTTTGGAGAGGAT pLKO.1 968 3UTR 100% 2.640 1.848 N Babam2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016369.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03245 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03245 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000476569 AACGGACTTGCCTCCATAAGCTCG pLX_317 53.8% 100% 100% V5 n/a
Download CSV