Transcript: Human XM_017022411.2

PREDICTED: Homo sapiens mitogen-activated protein kinase kinase 1 (MAP2K1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MAP2K1 (5604)
Length:
2448
CDS:
416..1519

Additional Resources:

NCBI RefSeq record:
XM_017022411.2
NBCI Gene record:
MAP2K1 (5604)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017022411.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000199799 GTCCTACATGTCGCCAGAAAG pLKO.1 1018 CDS 100% 10.800 15.120 N MAP2K1 n/a
2 TRCN0000344506 GTCCTACATGTCGCCAGAAAG pLKO_005 1018 CDS 100% 10.800 15.120 N MAP2K1 n/a
3 TRCN0000002329 GCTTCTATGGTGCGTTCTACA pLKO.1 798 CDS 100% 4.950 6.930 N MAP2K1 n/a
4 TRCN0000344571 GCTTCTATGGTGCGTTCTACA pLKO_005 798 CDS 100% 4.950 6.930 N MAP2K1 n/a
5 TRCN0000002332 GATTACATAGTCAACGAGCCT pLKO.1 1280 CDS 100% 0.660 0.924 N MAP2K1 n/a
6 TRCN0000199961 CTGGAGATCAAACCCGCAATC pLKO.1 716 CDS 100% 6.000 4.200 N MAP2K1 n/a
7 TRCN0000002330 CTGATGCTGAGGAAGTGGATT pLKO.1 1428 CDS 100% 4.950 3.465 N MAP2K1 n/a
8 TRCN0000002331 GAGGGAGAAGCACAAGATCAT pLKO.1 877 CDS 100% 4.950 3.465 N MAP2K1 n/a
9 TRCN0000195621 CCCATATCCAAGTACCAATGC pLKO.1 2295 3UTR 100% 4.050 2.835 N MAP2K1 n/a
10 TRCN0000219683 GTCATGGCCAGAAAGCTAATT pLKO.1 692 CDS 100% 13.200 7.920 N MAP2K1 n/a
11 TRCN0000219685 TTGACATTTGGTGGTACTTTA pLKO.1 1885 3UTR 100% 13.200 7.920 N MAP2K1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017022411.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroad304_14807 pLX_304 50.7% 93.3% 39.2% V5 (not translated due to prior stop codon) 413_414insG;438_439ins78 n/a
2 ccsbBroadEn_14807 pDONR223 100% 93.2% 39.2% None 413_414insG;438_439ins78;525_526insG n/a
3 TRCN0000492332 GTGTTATTTGGCCTAAGAGCTCAC pLX_317 33.1% 93.3% 93.1% V5 438_439ins78;1101_1102insG n/a
4 ccsbBroadEn_16176 pDONR223 0% 93% 92.8% None 438_439ins78;574_575delTCinsGA;586_587delTCinsGA n/a
5 ccsbBroad304_16176 pLX_304 0% 93% 92.8% V5 438_439ins78;574_575delTCinsGA;586_587delTCinsGA n/a
Download CSV