Transcript: Human XM_005254606.2

PREDICTED: Homo sapiens solute carrier family 12 member 1 (SLC12A1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC12A1 (6557)
Length:
4708
CDS:
216..3515

Additional Resources:

NCBI RefSeq record:
XM_005254606.2
NBCI Gene record:
SLC12A1 (6557)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005254606.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000042925 CGTCTCCATGAAAGCTGCAAA pLKO.1 3210 CDS 100% 4.950 6.930 N SLC12A1 n/a
2 TRCN0000042926 GCTGGTAAGATGCATGCTGAA pLKO.1 764 CDS 100% 4.050 5.670 N SLC12A1 n/a
3 TRCN0000042923 GCCCAGTAATACCAATCGCTT pLKO.1 257 CDS 100% 2.640 3.696 N SLC12A1 n/a
4 TRCN0000042927 GCATTTATTCTTATTGCGGAA pLKO.1 1884 CDS 100% 2.160 3.024 N SLC12A1 n/a
5 TRCN0000418044 CACTCTGGTGATTGGATATAA pLKO_005 2540 CDS 100% 15.000 10.500 N SLC12A1 n/a
6 TRCN0000421955 AGTACGGGCTGATGAACAATT pLKO_005 1642 CDS 100% 13.200 9.240 N SLC12A1 n/a
7 TRCN0000042924 GCTCCCATCATCTCCAACTTT pLKO.1 1917 CDS 100% 5.625 3.938 N SLC12A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005254606.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11139 pDONR223 100% 37.3% 36.3% None (many diffs) n/a
2 ccsbBroad304_11139 pLX_304 0% 37.3% 36.3% V5 (many diffs) n/a
3 TRCN0000466651 GTAGTATTTCTTAAATAGCTGGAA pLX_317 34.1% 37.3% 36.3% V5 (many diffs) n/a
Download CSV