Transcript: Human XM_024446676.1

PREDICTED: Homo sapiens ETS variant transcription factor 1 (ETV1), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ETV1 (2115)
Length:
4281
CDS:
23..1444

Additional Resources:

NCBI RefSeq record:
XM_024446676.1
NBCI Gene record:
ETV1 (2115)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024446676.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430096 CAACGAAGGCTACGTGTATTA pLKO_005 1423 CDS 100% 13.200 18.480 N ETV1 n/a
2 TRCN0000418451 TATCCACTTGGAGACTATTTG pLKO_005 1849 3UTR 100% 13.200 18.480 N ETV1 n/a
3 TRCN0000428550 AGCCGTTCACTCCGCTATTAC pLKO_005 1178 CDS 100% 13.200 9.240 N ETV1 n/a
4 TRCN0000013924 CCACAGTCCATGTTCAGAAAT pLKO.1 286 CDS 100% 13.200 9.240 N ETV1 n/a
5 TRCN0000013923 GTGGGAGTAATCTAAACATTT pLKO.1 1633 3UTR 100% 13.200 9.240 N ETV1 n/a
6 TRCN0000013927 GAGAGATATGTCTACAAGTTT pLKO.1 1232 CDS 100% 5.625 3.938 N ETV1 n/a
7 TRCN0000013925 CGACCCAGTGTATGAACACAA pLKO.1 706 CDS 100% 4.950 3.465 N ETV1 n/a
8 TRCN0000013926 GCATCTCCAAACTCAACTCAT pLKO.1 461 CDS 100% 4.950 3.465 N ETV1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024446676.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00520 pDONR223 100% 91.5% 90.3% None (many diffs) n/a
2 ccsbBroad304_00520 pLX_304 27.6% 91.5% 90.3% V5 (many diffs) n/a
3 TRCN0000469733 CACAGGTTACAGTGGTGTTCAGCC pLX_317 10.3% 91.5% 90.3% V5 (many diffs) n/a
Download CSV