Transcript: Human NM_001199469.2

Homo sapiens ISY1 splicing factor homolog (ISY1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
ISY1 (57461)
Length:
3678
CDS:
89..1012

Additional Resources:

NCBI RefSeq record:
NM_001199469.2
NBCI Gene record:
ISY1 (57461)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001199469.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000296542 GCTACTGTGTGGATCCATTTA pLKO_005 1205 3UTR 100% 13.200 9.240 N ISY1 n/a
2 TRCN0000075128 GAAGAATCAATTAGTGGCAAA pLKO.1 1307 3UTR 100% 4.050 2.835 N ISY1 n/a
3 TRCN0000296601 ACCGAGGTTACAAGTACTTTG pLKO_005 438 CDS 100% 10.800 5.400 Y ISY1 n/a
4 TRCN0000075132 CAGATTCAGAATGCTGGTTTA pLKO.1 263 CDS 100% 10.800 5.400 Y ISY1 n/a
5 TRCN0000075130 CCTTTGGAACAGGAATATGAA pLKO.1 668 CDS 100% 5.625 2.813 Y ISY1 n/a
6 TRCN0000290332 CCTTTGGAACAGGAATATGAA pLKO_005 668 CDS 100% 5.625 2.813 Y ISY1 n/a
7 TRCN0000075129 CCTGGTGTTAGAGAGCTGTTT pLKO.1 476 CDS 100% 4.950 2.475 Y ISY1 n/a
8 TRCN0000075131 GCTCAGATTCAGAATGCTGGT pLKO.1 260 CDS 100% 2.160 1.080 Y ISY1 n/a
9 TRCN0000290267 GCTCAGATTCAGAATGCTGGT pLKO_005 260 CDS 100% 2.160 1.080 Y ISY1 n/a
10 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 526 CDS 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001199469.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03823 pDONR223 100% 92.8% 92.5% None 419_484del n/a
2 ccsbBroad304_03823 pLX_304 0% 92.8% 92.5% V5 419_484del n/a
3 TRCN0000477283 AGCCCGACGAAGATAGAGGTATTT pLX_317 43.3% 92.8% 92.5% V5 419_484del n/a
Download CSV