Transcript: Human NM_001164283.3

Homo sapiens TRAF3 interacting protein 2 (TRAF3IP2), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-08-21
Taxon:
Homo sapiens (human)
Gene:
TRAF3IP2 (10758)
Length:
4427
CDS:
74..403

Additional Resources:

NCBI RefSeq record:
NM_001164283.3
NBCI Gene record:
TRAF3IP2 (10758)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001164283.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000162747 CCGTGATGATAATCGTAGCAA pLKO.1 69 5UTR 100% 3.000 4.200 N TRAF3IP2 n/a
2 TRCN0000160964 GCTTCAGAACACTCATGTCTA pLKO.1 274 CDS 100% 4.950 3.465 N TRAF3IP2 n/a
3 TRCN0000072628 CCTCCCAAAGTGCTAGGATTA pLKO.1 2918 3UTR 100% 10.800 5.400 Y MRPS16 n/a
4 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 1093 3UTR 100% 4.950 2.475 Y CFLAR n/a
5 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 1093 3UTR 100% 4.950 2.475 Y C19orf31 n/a
6 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 2098 3UTR 100% 4.950 2.475 Y ERAP2 n/a
7 TRCN0000155229 GATCAAGACCATCCTGGCTAA pLKO.1 2153 3UTR 100% 4.050 2.025 Y INTS7 n/a
8 TRCN0000040213 CCTCCCAAATTGCTGGGATTA pLKO.1 3941 3UTR 100% 1.080 0.540 Y IGF1 n/a
9 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2099 3UTR 100% 13.200 6.600 Y LIAS n/a
10 TRCN0000140657 CCTCCCAAAGTGCTAGGATAA pLKO.1 2918 3UTR 100% 10.800 5.400 Y CD3EAP n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2023 3UTR 100% 5.625 2.813 Y KLHL30 n/a
12 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 1091 3UTR 100% 4.950 2.475 Y ERN2 n/a
13 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 1091 3UTR 100% 4.950 2.475 Y P3H4 n/a
14 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 1091 3UTR 100% 4.950 2.475 Y P3H4 n/a
15 TRCN0000139610 CGAACTCCTGACCTTGTGATA pLKO.1 1987 3UTR 100% 4.950 2.475 Y RBM48 n/a
16 TRCN0000014673 GCAGATCATTTGAGGTCAGAA pLKO.1 1129 3UTR 100% 4.950 2.475 Y ZNF14 n/a
17 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2023 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001164283.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07674 pDONR223 100% 19.2% 19.2% None 0_1ins1368 n/a
2 ccsbBroad304_07674 pLX_304 0% 19.2% 19.2% V5 0_1ins1368 n/a
3 TRCN0000477300 AGGTGTCGGCCGTTAGCTATAACC pLX_317 24.7% 19.2% 19.2% V5 0_1ins1368 n/a
Download CSV