Transcript: Human XM_005249919.3

PREDICTED: Homo sapiens engulfment and cell motility 1 (ELMO1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ELMO1 (9844)
Length:
4055
CDS:
682..2865

Additional Resources:

NCBI RefSeq record:
XM_005249919.3
NBCI Gene record:
ELMO1 (9844)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005249919.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426180 CCATGTACACGCGAGATTATA pLKO_005 1730 CDS 100% 15.000 21.000 N ELMO1 n/a
2 TRCN0000029069 CCGATAGTTCAAACTTCTATA pLKO.1 842 CDS 100% 13.200 18.480 N ELMO1 n/a
3 TRCN0000425011 AGGAAATGGCCTAGCTATTTG pLKO_005 3276 3UTR 100% 13.200 9.240 N ELMO1 n/a
4 TRCN0000029070 CCTATACTATTGCAGTGATTA pLKO.1 1403 CDS 100% 13.200 9.240 N ELMO1 n/a
5 TRCN0000029071 CCCAAACTCATGGAAATTGAT pLKO.1 736 CDS 100% 5.625 3.938 N ELMO1 n/a
6 TRCN0000029072 GCCAGAAATCTTAGAGCTGAT pLKO.1 2304 CDS 100% 4.050 2.835 N ELMO1 n/a
7 TRCN0000029073 CCAAATCACAAAGTCCTGCAT pLKO.1 2422 CDS 100% 2.640 1.848 N ELMO1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005249919.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07496 pDONR223 100% 99.9% 100% None 399G>A n/a
2 ccsbBroad304_07496 pLX_304 0% 99.9% 100% V5 399G>A n/a
3 TRCN0000467712 AATACTATAATCCGTAGTAGGAGA pLX_317 18.5% 99.9% 100% V5 399G>A n/a
4 ccsbBroadEn_02259 pDONR223 100% 33.9% 33.9% None 1_1440del n/a
5 ccsbBroad304_02259 pLX_304 0% 33.9% 33.9% V5 1_1440del n/a
Download CSV