Construct: ORF TRCN0000467712
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF010229.1_s317c1
- Derived from:
- ccsbBroadEn_07496
- DNA Barcode:
- AATACTATAATCCGTAGTAGGAGA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ELMO1 (9844)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000467712
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 9844 | ELMO1 | engulfment and cell motility 1 | NM_001206480.2 | 99.9% | 100% | 399G>A |
| 2 | human | 9844 | ELMO1 | engulfment and cell motility 1 | NM_001206482.1 | 99.9% | 100% | 399G>A |
| 3 | human | 9844 | ELMO1 | engulfment and cell motility 1 | NM_014800.10 | 99.9% | 100% | 399G>A |
| 4 | human | 9844 | ELMO1 | engulfment and cell motility 1 | XM_005249919.3 | 99.9% | 100% | 399G>A |
| 5 | human | 9844 | ELMO1 | engulfment and cell motility 1 | XM_006715805.1 | 99.9% | 100% | 399G>A |
| 6 | human | 9844 | ELMO1 | engulfment and cell motility 1 | XM_011515654.2 | 99.9% | 100% | 399G>A |
| 7 | human | 9844 | ELMO1 | engulfment and cell motility 1 | XM_017012839.1 | 99.9% | 100% | 399G>A |
| 8 | human | 9844 | ELMO1 | engulfment and cell motility 1 | XM_024447008.1 | 99.9% | 100% | 399G>A |
| 9 | human | 9844 | ELMO1 | engulfment and cell motility 1 | XR_001744894.2 | 55.5% | (many diffs) | |
| 10 | human | 9844 | ELMO1 | engulfment and cell motility 1 | NM_001039459.2 | 33.9% | 33.9% | 0_1ins1440 |
| 11 | human | 9844 | ELMO1 | engulfment and cell motility 1 | NM_130442.3 | 33.9% | 33.9% | 0_1ins1440 |
| 12 | mouse | 140580 | Elmo1 | engulfment and cell motility 1 | NM_080288.2 | 90.8% | 99.5% | (many diffs) |
| 13 | mouse | 140580 | Elmo1 | engulfment and cell motility 1 | XM_006516547.3 | 90.8% | 99.5% | (many diffs) |
| 14 | mouse | 140580 | Elmo1 | engulfment and cell motility 1 | XM_006516544.3 | 89% | 97.5% | (many diffs) |
| 15 | mouse | 140580 | Elmo1 | engulfment and cell motility 1 | XM_006516545.3 | 89% | 97.5% | (many diffs) |
| 16 | mouse | 140580 | Elmo1 | engulfment and cell motility 1 | XM_006516546.3 | 89% | 97.5% | (many diffs) |
| 17 | mouse | 140580 | Elmo1 | engulfment and cell motility 1 | XM_017315380.1 | 78.7% | 86.5% | (many diffs) |
| 18 | mouse | 140580 | Elmo1 | engulfment and cell motility 1 | NM_198093.3 | 31.5% | 33.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 2250
- ORF length:
- 2181
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gccgccaccc gcggacatcg tcaaggtggc catagaatgg ccgggcgcct 121 accccaaact catggaaatt gatcagaaaa aaccactgtc tgcaataata aaggaagtct 181 gtgatgggtg gtctcttgcc aaccatgaat attttgcact ccagcatgcc gatagttcaa 241 acttctatat cacagaaaag aaccgcaatg agataaaaaa tggcactatc cttcgattaa 301 ccacatctcc agctcagaac gcccagcagc tccatgaacg aatccagtcc tcgagtatgg 361 atgccaagct ggaagccctg aaggacttgg ccagcctctc ccgggatgtc acgtttgccc 421 aggagtttat aaacctggac ggtatctctc tcctcacgca gatggtagag agcggcactg 481 agcgatacca gaaattgcag aagatcatga agccttgctt tggagacatg ctgtccttca 541 ccctgacggc cttcgttgag ctgatggacc atggcatagt gtcctgggat acattttcgg 601 tggcgttcat taagaagata gcaagttttg tgaacaagtc agccatagac atctcgatcc 661 tgcagcggtc cttggccatt ttggagtcga tggtgctcaa tagccatgac ctctaccaga 721 aagtggcgca ggagatcacc atcggccagc tcattccaca cctgcaaggg tcagatcaag 781 aaatccaaac ctatactatt gcagtgatta atgcgctttt cctgaaggct cctgatgaga 841 ggaggcagga gatggcgaat attttggctc agaagcaact gcgttccatc attttaacac 901 atgtcatccg agcccagcgg gccatcaaca atgagatggc gcaccagctg tatgttctac 961 aagtgctcac ctttaacctc ctggaagaca ggatgatgac caaaatggac ccccaggacc 1021 aggctcagag ggacatcata tttgaacttc gaagaattgc ttttgatgct gagtctgaac 1081 ctaacaacag cagtggcagc atggagaaac gcaagtccat gtacacgcga gattataaga 1141 agcttgggtt cattaatcat gtcaaccctg ccatggactt cacgcagact ccacctggga 1201 tgttggctct ggacaacatg ctgtactttg ccaagcacca ccaagatgcc tacatccgga 1261 ttgtgcttga gaacagtagt cgagaagaca agcatgaatg tccctttggc cgcagtagta 1321 tagagctgac caagatgcta tgtgagatct tgaaagtggg cgagttgcct agtgagacct 1381 gcaacgactt ccacccgatg ttcttcaccc acgacagatc ctttgaggag tttttctgca 1441 tctgtatcca gctcctgaac aagacatgga aggaaatgag ggcaacttct gaagacttca 1501 acaaggtaat gcaggtggtg aaggagcagg ttatgagagc acttacaacc aagcctagct 1561 ccctggacca gttcaagagc aaactgcaga acctgagcta cactgagatc ctgaaaatcc 1621 gccagtccga gaggatgaac caggaagatt tccagtcccg cccgattttg gaactaaagg 1681 agaagattca gccagaaatc ttagagctga tcaaacagca acgcctgaac cgccttgtgg 1741 aagggacctg ctttaggaaa ctcaatgccc ggcggaggca agacaagttt tggtattgtc 1801 ggctttcgcc aaatcacaaa gtcctgcatt acggagactt agaagagagt ccTCAGGGAG 1861 AAGTGCCCCA CGATTCCTTG CAGGACAAAC TGCCGGTGGC AGATATCAAA GCCGTGGTGA 1921 CGGGAAAGGA CTGCCCTCAT ATGAAAGAGA AAGGTGCCCT TAAACAAAAC AAGGAGGTGC 1981 TTGAACTCGC TTTCTCCATC TTGTATGACT CAAACTGCCA ACTGAACTTC ATCGCTCCTG 2041 ACAAGCATGA GTACTGTATC TGGACGGATG GACTGAATGC GCTACTCGGG AAGGACATGA 2101 TGAGCGACCT GACGCGGAAT GACCTGGACA CCCTGCTCAG CATGGAAATC AAGCTCCGCC 2161 TCCTGGACCT GGAAAACATC CAGATCCCTG ACGCACCTCC GCCGATTCCC AAGGAGCCCA 2221 GCAACTATGA CTTCGTCTAT GACTGTAACT TGCCAACTTT CTTGTACAAA GTGGTTGATA 2281 TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC 2341 CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGAAATAC 2401 TATAATCCGT AGTAGGAGAA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg 2461 tgaaagatt