Transcript: Human NM_001017930.2

Homo sapiens DDB1 and CUL4 associated factor 8 like 1 (DCAF8L1), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
DCAF8L1 (139425)
Length:
3458
CDS:
116..1918

Additional Resources:

NCBI RefSeq record:
NM_001017930.2
NBCI Gene record:
DCAF8L1 (139425)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001017930.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000141580 CGGTTCTGTCAGTACCATACA pLKO.1 703 CDS 100% 4.950 3.960 N DCAF8L1 n/a
2 TRCN0000121821 GATGAAGACAACTTGAACTAT pLKO.1 1712 CDS 100% 5.625 3.938 N DCAF8L1 n/a
3 TRCN0000121997 GTGATGGTGCTCAATATGTTA pLKO.1 1380 CDS 100% 5.625 3.938 N DCAF8L1 n/a
4 TRCN0000121957 CGGACTGTATACAATCTCTAT pLKO.1 1120 CDS 100% 4.950 3.465 N DCAF8L1 n/a
5 TRCN0000143901 CCAGATGAAGAAGAGTTGGAT pLKO.1 1829 CDS 100% 3.000 2.100 N DCAF8L1 n/a
6 TRCN0000143129 CAGTATCTTCTTGGAAGCCAT pLKO.1 680 CDS 100% 2.640 1.848 N DCAF8L1 n/a
7 TRCN0000142954 CCAGAGGAGAATTGATGAGAA pLKO.1 2522 3UTR 100% 4.950 2.970 N DCAF8L1 n/a
8 TRCN0000122739 CCACCTAAGTACACTGGACTT pLKO.1 1946 3UTR 100% 4.050 2.025 Y DCAF8L1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001017930.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13612 pDONR223 100% 85.1% 76.6% None (many diffs) n/a
2 ccsbBroad304_13612 pLX_304 0% 85.1% 76.6% V5 (many diffs) n/a
3 TRCN0000475832 TATTACTTCGTAATCTGTCTCGCA pLX_317 20% 85.1% 76.6% V5 (many diffs) n/a
Download CSV