Transcript: Human XM_024448567.1

PREDICTED: Homo sapiens neurotrimin (NTM), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NTM (50863)
Length:
6021
CDS:
222..1322

Additional Resources:

NCBI RefSeq record:
XM_024448567.1
NBCI Gene record:
NTM (50863)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024448567.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000113596 CGTGAACTATCCACCATACAT pLKO.1 818 CDS 100% 5.625 7.875 N Ntm n/a
2 TRCN0000161782 CGTGAACTATCCACCATACAT pLKO.1 818 CDS 100% 5.625 7.875 N NTM n/a
3 TRCN0000420978 CATTAATGAAGGGAACAATAT pLKO_005 602 CDS 100% 13.200 9.240 N NTM n/a
4 TRCN0000159423 GTGAAGACGAATACTTGGAAA pLKO.1 706 CDS 100% 4.950 3.465 N NTM n/a
5 TRCN0000165602 GTACAGCATCGAGATCCAGAA pLKO.1 455 CDS 100% 4.050 2.835 N NTM n/a
6 TRCN0000162384 CAGTGGTACAAGGATGACAAA pLKO.1 924 CDS 100% 4.950 2.475 Y NTM n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024448567.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08191 pDONR223 100% 74.5% 74% None (many diffs) n/a
2 ccsbBroad304_08191 pLX_304 0% 74.5% 74% V5 (many diffs) n/a
3 TRCN0000467633 TGAACTCCATTTGGGGCGGGAACC pLX_317 41.5% 74.5% 74% V5 (many diffs) n/a
Download CSV