Transcript: Human XR_001736967.2

PREDICTED: Homo sapiens lysophospholipase like 1 (LYPLAL1), transcript variant X6, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LYPLAL1 (127018)
Length:
2174
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001736967.2
NBCI Gene record:
LYPLAL1 (127018)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001736967.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000078210 TCCCAGATCATATACTCCTAT pLKO.1 227 3UTR 100% 4.950 6.435 N LYPLAL1 n/a
2 TRCN0000418336 GGTGTACTTCCTGAATTATTT pLKO_005 537 3UTR 100% 15.000 12.000 N LYPLAL1 n/a
3 TRCN0000413417 TAGGAGTGACCACGAAGTTTC pLKO_005 631 3UTR 100% 10.800 7.560 N LYPLAL1 n/a
4 TRCN0000078209 GCCCAGAACACCTTGAATCAA pLKO.1 301 3UTR 100% 5.625 3.938 N LYPLAL1 n/a
5 TRCN0000078212 GAGTATTTGCTCTTTCTAGTT pLKO.1 469 3UTR 100% 4.950 3.465 N LYPLAL1 n/a
6 TRCN0000078208 GCAGATGAGTTAGTTCTTCAT pLKO.1 573 3UTR 100% 4.950 3.465 N LYPLAL1 n/a
7 TRCN0000078211 CCAAATGTTTACCATGAGCTA pLKO.1 660 3UTR 100% 2.640 1.848 N LYPLAL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001736967.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04821 pDONR223 100% 32.6% None 1_41del;434A>G;753_2174del n/a
2 ccsbBroad304_04821 pLX_304 0% 32.6% V5 1_41del;434A>G;753_2174del n/a
3 TRCN0000473255 TAGAGTCTAGATGGGACAACACCT pLX_317 69% 32.6% V5 1_41del;434A>G;753_2174del n/a
Download CSV