Transcript: Human NM_018393.4

Homo sapiens t-complex 11 like 1 (TCP11L1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
TCP11L1 (55346)
Length:
2649
CDS:
246..1775

Additional Resources:

NCBI RefSeq record:
NM_018393.4
NBCI Gene record:
TCP11L1 (55346)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018393.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000275740 CGTCCGATCCTAACGTGTATG pLKO_005 1763 CDS 100% 10.800 15.120 N TCP11L1 n/a
2 TRCN0000130627 CCTACTACGATGCAATCCTGA pLKO.1 1732 CDS 100% 2.640 3.696 N TCP11L1 n/a
3 TRCN0000129700 CGATTCCAAAGGGAAGAATAT pLKO.1 1887 3UTR 100% 13.200 10.560 N TCP11L1 n/a
4 TRCN0000129246 CGAATCCTGACCTTCTTAGAA pLKO.1 1578 CDS 100% 5.625 4.500 N TCP11L1 n/a
5 TRCN0000127846 GCAGGATCATGGAATCTCGAA pLKO.1 1561 CDS 100% 2.640 2.112 N TCP11L1 n/a
6 TRCN0000275741 TTTGTTAGAAGGGCTATATAA pLKO_005 2227 3UTR 100% 15.000 10.500 N TCP11L1 n/a
7 TRCN0000130168 CCGATTCCAAAGGGAAGAATA pLKO.1 1886 3UTR 100% 13.200 9.240 N TCP11L1 n/a
8 TRCN0000275798 GCTCGCCTGGTCAACTATAAC pLKO_005 1695 CDS 100% 13.200 9.240 N TCP11L1 n/a
9 TRCN0000200624 CCTGGTCAACTATAACAAGAT pLKO.1 1700 CDS 100% 4.950 3.465 N Tcp11l1 n/a
10 TRCN0000129802 CTAGCCCATGAAATTGTAGTA pLKO.1 477 CDS 100% 4.950 3.465 N TCP11L1 n/a
11 TRCN0000129646 CTGAGAAACCAGATAACAGAA pLKO.1 699 CDS 100% 4.950 3.465 N TCP11L1 n/a
12 TRCN0000275799 CTGAGAAACCAGATAACAGAA pLKO_005 699 CDS 100% 4.950 3.465 N TCP11L1 n/a
13 TRCN0000129136 GCTGGAGGAAGTTGCTATTAA pLKO.1 1670 CDS 100% 15.000 9.000 N TCP11L1 n/a
14 TRCN0000275800 GCTGGAGGAAGTTGCTATTAA pLKO_005 1670 CDS 100% 15.000 9.000 N TCP11L1 n/a
15 TRCN0000191863 GCCCATGAAATTGTAGTAACT pLKO.1 480 CDS 100% 4.950 3.465 N Tcp11l1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018393.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08528 pDONR223 100% 99.8% 99.8% None 216T>C;533A>G;1488C>A n/a
2 ccsbBroad304_08528 pLX_304 0% 99.8% 99.8% V5 216T>C;533A>G;1488C>A n/a
3 TRCN0000475928 ACATGGGCCGCACTATCAACGCCA pLX_317 17.2% 99.8% 99.8% V5 216T>C;533A>G;1488C>A n/a
Download CSV