Construct: ORF TRCN0000475928
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF012408.1_s317c1
- Derived from:
- ccsbBroadEn_08528
- DNA Barcode:
- ACATGGGCCGCACTATCAACGCCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TCP11L1 (55346)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475928
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 55346 | TCP11L1 | t-complex 11 like 1 | NM_001145541.1 | 99.8% | 99.8% | 216T>C;533A>G;1488C>A |
2 | human | 55346 | TCP11L1 | t-complex 11 like 1 | NM_018393.4 | 99.8% | 99.8% | 216T>C;533A>G;1488C>A |
3 | human | 55346 | TCP11L1 | t-complex 11 like 1 | XM_011520207.2 | 99.8% | 99.8% | 216T>C;533A>G;1488C>A |
4 | human | 55346 | TCP11L1 | t-complex 11 like 1 | XM_017017990.1 | 99.8% | 99.8% | 216T>C;533A>G;1488C>A |
5 | human | 55346 | TCP11L1 | t-complex 11 like 1 | XM_011520204.2 | 98.8% | 98.6% | (many diffs) |
6 | human | 55346 | TCP11L1 | t-complex 11 like 1 | XM_011520205.2 | 98.8% | 98.6% | (many diffs) |
7 | human | 55346 | TCP11L1 | t-complex 11 like 1 | XM_011520206.2 | 98.8% | 98.6% | (many diffs) |
8 | human | 55346 | TCP11L1 | t-complex 11 like 1 | XM_017017989.2 | 98.8% | 98.6% | (many diffs) |
9 | human | 55346 | TCP11L1 | t-complex 11 like 1 | XM_017017991.1 | 63.5% | 63.6% | 0_1ins555;933C>A |
10 | human | 55346 | TCP11L1 | t-complex 11 like 1 | XM_017017992.1 | 63.5% | 63.6% | 0_1ins555;933C>A |
11 | human | 55346 | TCP11L1 | t-complex 11 like 1 | XR_001747920.2 | 15.3% | (many diffs) | |
12 | mouse | 320554 | Tcp11l1 | t-complex 11 like 1 | NM_177190.5 | 85.3% | 85% | (many diffs) |
13 | mouse | 320554 | Tcp11l1 | t-complex 11 like 1 | XM_006499734.3 | 85.3% | 85% | (many diffs) |
14 | mouse | 320554 | Tcp11l1 | t-complex 11 like 1 | XM_006499735.3 | 73.8% | 74.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1596
- ORF length:
- 1527
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gtctgaaaac cttgacaagt ccaatgtaaa tgaagcagga aaatcaaaat 121 ccaatgattc tgaggaaggc ctcgaagatg ctgtggaagg tgctgatgaa gccttacaaa 181 aagcaataaa gtcagactcc tccagccccc aaagagtgca gagacctcac tctagtcctc 241 ctcgctttgt gacagtagaa gaacttctag agacagcgag aggcgtcacc aacatggctc 301 tagcccatga aattgtagta aatggagact ttcagattaa accagttgaa ttaccagaaa 361 acagcttgaa gaagagagta aaggagattg tacataaagc gttttgggat tgcttgagtg 421 tgcagctaag tgaagatccc ccagcatatg accatgctat caaacttgta ggagaaatca 481 aagagactct cttatctttc ttgctgcctg gtcatactag actgagaaac cagataacag 541 aagtcttgga tctggatctg ataaagcagg aagcagagaa tggggcgcta gacatttcca 601 ggctggcaga attcattatt ggcatgatgg ggacactgtg tgcacctgct cgagatgagg 661 aagttaagaa actaaaggac attaaggaaa tagtgcccct tttcagagaa attttttctg 721 tgttggacct aatgaaagtg gacatggcca actttgctat cagtagcatc aggcctcatc 781 tcatgcagca gtcagttgaa tacgaaagga agaagtttca agagattttg gagaggcaac 841 caaattccct ggactttgtc acccagtggc tggaagaagc ctcagaggac cttatgactc 901 agaagtataa acacgccctg ccagtggggg gaatggctgc tggctctggg gacatgccca 961 ggctgagccc tgttgctgtc cagaattacg cttacctgaa gcttctgaag tgggaccacc 1021 tccagaggcc gttccccgaa acagttttaa tggaccagtc tcgcttccac gagctccagt 1081 tgcagctgga acaactgacc atcctggggg ctgtgttgct ggtcaccttc agcatggcag 1141 cgccaggaat ttccagccag gccgactttg ctgagaaact caagatgatt gtgaagattt 1201 tgctaacaga tatgcacctg ccctccttcc atctgaagga cgtcctcact accatcgggg 1261 agaaggtgtg cctggaggtg agcagctgcc tctccctgtg tgggtcctct cccttcacca 1321 cggacaagga gaccgtgctC AAGGGCCAGA TCCAGGCCGT GGCCAGTCCC GATGACCCCA 1381 TTCGCAGGAT CATGGAATCT CGAATCCTGA CCTTCTTAGA AACCTACCTT GCCTCGGGTC 1441 ATCAGAAGCC ATTGCCCACA GTCCCTGGGG GACTCAGTCC AGTTCAGAGA GAGCTGGAGG 1501 AAGTTGCTAT TAAATTTGCT CGCCTGGTCA ACTATAACAA GATGGTCTTC TGTCCATACT 1561 ACGATGCAAT CCTGAGTAAG ATCCTCGTCC GATCCTTGCC AACTTTCTTG TACAAAGTGG 1621 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 1681 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 1741 AACATGGGCC GCACTATCAA CGCCAACGCG TTAAGTCgac aatcaacctc tggattacaa 1801 aatttgtgaa agatt