Transcript: Human XM_017012750.2

PREDICTED: Homo sapiens cyclin dependent kinase 13 (CDK13), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CDK13 (8621)
Length:
7761
CDS:
979..5607

Additional Resources:

NCBI RefSeq record:
XM_017012750.2
NBCI Gene record:
CDK13 (8621)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017012750.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000000704 CGATGTCTTCTTGCTGATTTA pLKO.1 2905 CDS 100% 13.200 18.480 N CDK13 n/a
2 TRCN0000352622 CGATGTCTTCTTGCTGATTTA pLKO_005 2905 CDS 100% 13.200 18.480 N CDK13 n/a
3 TRCN0000194677 CGATTGTACATCTTCACAAAT pLKO.1 5807 3UTR 100% 13.200 18.480 N CDK13 n/a
4 TRCN0000195638 CCACTAGAACGACGTAGTTTC pLKO.1 5152 CDS 100% 10.800 15.120 N CDK13 n/a
5 TRCN0000194804 CGACGTAGTTTCATTGGAAAT pLKO.1 5161 CDS 100% 10.800 8.640 N CDK13 n/a
6 TRCN0000342369 CGACGTAGTTTCATTGGAAAT pLKO_005 5161 CDS 100% 10.800 8.640 N CDK13 n/a
7 TRCN0000195065 CTGAGGAAGATCTAGATTATC pLKO.1 4880 CDS 100% 13.200 9.240 N CDK13 n/a
8 TRCN0000352631 CTGAGGAAGATCTAGATTATC pLKO_005 4880 CDS 100% 13.200 9.240 N CDK13 n/a
9 TRCN0000196896 GCTGATAGCTTACGAGGAAAT pLKO.1 2842 CDS 100% 10.800 7.560 N CDK13 n/a
10 TRCN0000352621 GCTGATAGCTTACGAGGAAAT pLKO_005 2842 CDS 100% 10.800 7.560 N CDK13 n/a
11 TRCN0000000702 GCTGCGCTAGACTTATTTGAT pLKO.1 3976 CDS 100% 5.625 3.938 N CDK13 n/a
12 TRCN0000000703 GCAATTCTACTAAACCTACTA pLKO.1 4345 CDS 100% 4.950 3.465 N CDK13 n/a
13 TRCN0000000700 AGTGTTATTGTGAAAGGTGTA pLKO.1 6096 3UTR 100% 4.050 2.835 N CDK13 n/a
14 TRCN0000000701 CCTGAAGATAAAGAAGCTGAT pLKO.1 2827 CDS 100% 4.050 2.835 N CDK13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017012750.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11288 pDONR223 100% 20.7% 20.1% None (many diffs) n/a
2 ccsbBroad304_11288 pLX_304 0% 20.7% 20.1% V5 (many diffs) n/a
3 TRCN0000470462 CGCGCTGGCGATCTTAACCCATCA pLX_317 41.9% 20.7% 20.1% V5 (many diffs) n/a
Download CSV