Transcript: Human XM_024449177.1

PREDICTED: Homo sapiens S100P binding protein (S100PBP), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
S100PBP (64766)
Length:
4430
CDS:
365..1591

Additional Resources:

NCBI RefSeq record:
XM_024449177.1
NBCI Gene record:
S100PBP (64766)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024449177.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000149735 GTGGTTCACACAAGTCAAGTT pLKO.1 1134 CDS 100% 4.950 6.930 N S100PBP n/a
2 TRCN0000276101 GTAACTGTTGCACCATTTAAT pLKO_005 800 CDS 100% 15.000 10.500 N S100PBP n/a
3 TRCN0000276100 CATGGACCAGCTCATACTAAA pLKO_005 737 CDS 100% 13.200 9.240 N S100PBP n/a
4 TRCN0000128004 GAACAGCAGAAGCAGCTTTAT pLKO.1 1319 CDS 100% 13.200 9.240 N S100PBP n/a
5 TRCN0000276102 GAACAGCAGAAGCAGCTTTAT pLKO_005 1319 CDS 100% 13.200 9.240 N S100PBP n/a
6 TRCN0000276099 TAACTTGTGAATGGATATAAG pLKO_005 2025 3UTR 100% 13.200 9.240 N S100PBP n/a
7 TRCN0000129313 CCATGAGAGAAGACTAGGCAA pLKO.1 1234 CDS 100% 2.640 1.848 N S100PBP n/a
8 TRCN0000148221 GAGACTCCTAATATGGAGTTA pLKO.1 1100 CDS 100% 0.495 0.347 N S100PBP n/a
9 TRCN0000127743 GAGAAGACTAGGCAAAGTCAT pLKO.1 1240 CDS 100% 4.950 2.970 N S100PBP n/a
10 TRCN0000276168 GAGAAGACTAGGCAAAGTCAT pLKO_005 1240 CDS 100% 4.950 2.970 N S100PBP n/a
11 TRCN0000430981 GCCACCATGCCTGGCTAATTT pLKO_005 3013 3UTR 100% 15.000 7.500 Y GTF2IRD2 n/a
12 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 49 5UTR 100% 5.625 2.813 Y KLHL30 n/a
13 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 49 5UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024449177.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08866 pDONR223 100% 99.9% 99.7% None 1224T>A n/a
2 ccsbBroad304_08866 pLX_304 0% 99.9% 99.7% V5 1224T>A n/a
3 TRCN0000466457 AACTACTTCACAGAAGCTGCCCAC pLX_317 20.8% 99.9% 99.7% V5 1224T>A n/a
Download CSV