Transcript: Human NM_001363879.1

Homo sapiens TATA element modulatory factor 1 (TMF1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
TMF1 (7110)
Length:
6888
CDS:
248..3538

Additional Resources:

NCBI RefSeq record:
NM_001363879.1
NBCI Gene record:
TMF1 (7110)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001363879.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000352791 CGTATGGAGAGCCGGGAATAA pLKO_005 375 CDS 100% 13.200 18.480 N TMF1 n/a
2 TRCN0000342841 ATATGCTTTAGTGCCTATTAT pLKO_005 1303 CDS 100% 15.000 10.500 N TMF1 n/a
3 TRCN0000342904 GAATAGCACAGAGATTTATTA pLKO_005 3788 3UTR 100% 15.000 10.500 N TMF1 n/a
4 TRCN0000342840 TGCCAGAAAGGAGGATTATTT pLKO_005 2452 CDS 100% 15.000 10.500 N TMF1 n/a
5 TRCN0000018533 GCTGCCAGAAAGGAGGATTAT pLKO.1 2450 CDS 100% 13.200 9.240 N TMF1 n/a
6 TRCN0000018534 CCAAACTTAGAACTCAGCTAA pLKO.1 3372 CDS 100% 4.950 3.465 N TMF1 n/a
7 TRCN0000018535 GCACAATTCTAACATCATCAA pLKO.1 1966 CDS 100% 4.950 3.465 N TMF1 n/a
8 TRCN0000018536 GCCCAGCTAGAATCAGAGAAA pLKO.1 2795 CDS 100% 4.950 3.465 N TMF1 n/a
9 TRCN0000342839 GCCCAGCTAGAATCAGAGAAA pLKO_005 2795 CDS 100% 4.950 3.465 N TMF1 n/a
10 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 4752 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001363879.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13970 pDONR223 100% 99.6% 54.1% None 1242C>T;1348_1356delGTAACTCTA;1786_1787insA n/a
2 ccsbBroad304_13970 pLX_304 0% 99.6% 54.1% V5 (not translated due to prior stop codon) 1242C>T;1348_1356delGTAACTCTA;1786_1787insA n/a
Download CSV