Transcript: Human XM_005262400.4

PREDICTED: Homo sapiens septin 6 (SEPTIN6), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SEPTIN6 (23157)
Length:
5761
CDS:
92..1567

Additional Resources:

NCBI RefSeq record:
XM_005262400.4
NBCI Gene record:
SEPTIN6 (23157)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005262400.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000139409 CCGAATCCATGTCTGCTTGTA pLKO.1 529 CDS 100% 4.950 6.930 N SEPTIN6 n/a
2 TRCN0000140163 GCTACAAGCCTATCGTGGAAT pLKO.1 432 CDS 100% 4.950 6.930 N SEPTIN6 n/a
3 TRCN0000278211 GCTACAAGCCTATCGTGGAAT pLKO_005 432 CDS 100% 4.950 6.930 N SEPTIN6 n/a
4 TRCN0000140002 GATGCTGATTCGGGTCAACAT pLKO.1 919 CDS 100% 4.950 3.960 N SEPTIN6 n/a
5 TRCN0000278210 GATGCTGATTCGGGTCAACAT pLKO_005 919 CDS 100% 4.950 3.960 N SEPTIN6 n/a
6 TRCN0000141845 GCCCTCATTTGCATTTGTGTA pLKO.1 3528 3UTR 100% 4.950 3.960 N SEPTIN6 n/a
7 TRCN0000140594 GATCGTTAGCACAGTTGGCTT pLKO.1 385 CDS 100% 2.640 2.112 N SEPTIN6 n/a
8 TRCN0000142333 CGAATCCATGTCTGCTTGTAT pLKO.1 530 CDS 100% 5.625 3.938 N SEPTIN6 n/a
9 TRCN0000278214 CGAATCCATGTCTGCTTGTAT pLKO_005 530 CDS 100% 5.625 3.938 N SEPTIN6 n/a
10 TRCN0000141217 CCATTTCGAAGAGTGAGCTAA pLKO.1 654 CDS 100% 4.950 3.465 N SEPTIN6 n/a
11 TRCN0000139410 CGGAGTCCAGATCTATCAGTT pLKO.1 715 CDS 100% 4.950 3.465 N SEPTIN6 n/a
12 TRCN0000278212 CGGAGTCCAGATCTATCAGTT pLKO_005 715 CDS 100% 4.950 3.465 N SEPTIN6 n/a
13 TRCN0000140207 GAGAAAGAAGCGGAGCTCAAA pLKO.1 1145 CDS 100% 4.950 3.465 N SEPTIN6 n/a
14 TRCN0000278213 GAGAAAGAAGCGGAGCTCAAA pLKO_005 1145 CDS 100% 4.950 3.465 N SEPTIN6 n/a
15 TRCN0000166364 CACACACACACACACACACAA pLKO.1 4337 3UTR 100% 4.950 2.475 Y KAAG1 n/a
16 TRCN0000112995 GCCATTATAGAAGAGTTAGTT pLKO.1 4794 3UTR 100% 5.625 3.938 N Sept6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005262400.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02725 pDONR223 100% 87.7% 87.3% None (many diffs) n/a
2 ccsbBroad304_02725 pLX_304 0% 87.7% 87.3% V5 (many diffs) n/a
3 TRCN0000479075 ATGGGTCGAGCGTTCGCTTGTACG pLX_317 27.3% 87.7% 87.3% V5 (many diffs) n/a
4 ccsbBroadEn_15750 pDONR223 0% 87.6% 87.1% None (many diffs) n/a
5 ccsbBroad304_15750 pLX_304 0% 87.6% 87.1% V5 (many diffs) n/a
6 TRCN0000473494 TTCTTAGCCAAGAGAAGACGAAAC pLX_317 45.3% 87.6% 87.1% V5 (many diffs) n/a
7 ccsbBroadEn_02724 pDONR223 100% 87.3% 86.9% None 1283C>T;1286_1289delACTG;1292_1473del n/a
8 ccsbBroad304_02724 pLX_304 0% 87.3% 86.9% V5 1283C>T;1286_1289delACTG;1292_1473del n/a
9 TRCN0000470256 TAGGAGACCTACACAGTATGTTGA pLX_317 33.5% 87.3% 86.9% V5 1283C>T;1286_1289delACTG;1292_1473del n/a
Download CSV