Transcript: Human NM_001018067.2

Homo sapiens SERPINE1 mRNA binding protein 1 (SERBP1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
SERBP1 (26135)
Length:
6726
CDS:
103..1329

Additional Resources:

NCBI RefSeq record:
NM_001018067.2
NBCI Gene record:
SERBP1 (26135)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001018067.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000159161 GAACTGTCAAAGACGAATTAA pLKO.1 776 CDS 100% 15.000 21.000 N SERBP1 n/a
2 TRCN0000292494 GAACTGTCAAAGACGAATTAA pLKO_005 776 CDS 100% 15.000 21.000 N SERBP1 n/a
3 TRCN0000166570 CCAACCGATTCGACCAGTTAT pLKO.1 143 CDS 100% 13.200 18.480 N SERBP1 n/a
4 TRCN0000162148 CCGATTATTGACCGACCTATT pLKO.1 568 CDS 100% 10.800 15.120 N SERBP1 n/a
5 TRCN0000162703 CGTGGCAAACGTGAATTTGAT pLKO.1 664 CDS 100% 5.625 7.875 N SERBP1 n/a
6 TRCN0000160878 GATTCGGTTATGGACCATCAT pLKO.1 1111 CDS 100% 4.950 3.960 N SERBP1 n/a
7 TRCN0000292415 GATTCGGTTATGGACCATCAT pLKO_005 1111 CDS 100% 4.950 3.960 N SERBP1 n/a
8 TRCN0000102478 CGCTTAAGAAAGAAGGAATAA pLKO.1 401 CDS 100% 13.200 9.240 N Serbp1 n/a
9 TRCN0000158959 GAAGGGATTTGTTCTTCATAA pLKO.1 1062 CDS 100% 13.200 9.240 N SERBP1 n/a
10 TRCN0000158855 GCGCTTAAGAAAGAAGGAATA pLKO.1 400 CDS 100% 10.800 7.560 N SERBP1 n/a
11 TRCN0000292401 GCGCTTAAGAAAGAAGGAATA pLKO_005 400 CDS 100% 10.800 7.560 N SERBP1 n/a
12 TRCN0000165990 GTTGGCGTGGTTGACAAGAAA pLKO.1 358 CDS 100% 5.625 3.938 N SERBP1 n/a
13 TRCN0000160845 GATCAACAACTTCAGGGTGAA pLKO.1 442 CDS 100% 4.050 2.835 N SERBP1 n/a
14 TRCN0000164928 GCTCATGCTGAAGATTCGGTT pLKO.1 1099 CDS 100% 2.640 1.848 N SERBP1 n/a
15 TRCN0000160685 CAGTGGAAGAAGGGATTTGTT pLKO.1 1054 CDS 100% 5.625 3.375 N SERBP1 n/a
16 TRCN0000165151 GCCGAGGAGATGGATTTGATT pLKO.1 641 CDS 100% 5.625 3.375 N SERBP1 n/a
17 TRCN0000292492 GCCGAGGAGATGGATTTGATT pLKO_005 641 CDS 100% 5.625 3.375 N SERBP1 n/a
18 TRCN0000162534 CCTGAAGGTGAAGAACATCAT pLKO.1 877 CDS 100% 4.950 2.970 N SERBP1 n/a
19 TRCN0000292495 CCTGAAGGTGAAGAACATCAT pLKO_005 877 CDS 100% 4.950 2.970 N SERBP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001018067.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02921 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02921 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000469935 CCCATGAGTAGGCCGAAGAGTCGG pLX_317 39.3% 100% 100% V5 n/a
4 ccsbBroadEn_02920 pDONR223 100% 98.5% 98.5% None 606_623del n/a
5 ccsbBroad304_02920 pLX_304 0% 98.5% 98.5% V5 606_623del n/a
6 TRCN0000471581 GTTGTGACCCGACCTTTTTGAGCC pLX_317 31.3% 98.5% 98.5% V5 606_623del n/a
7 ccsbBroadEn_07992 pDONR223 100% 98.4% 98.2% None 606_623del;1126C>T n/a
8 ccsbBroad304_07992 pLX_304 0% 98.4% 98.2% V5 606_623del;1126C>T n/a
9 TRCN0000479415 GAAAGACACCAATGTTAGCACCGC pLX_317 29.8% 98.4% 98.2% V5 606_623del;1126C>T n/a
10 ccsbBroadEn_15781 pDONR223 0% 94.8% 94.8% None 606_623del;696_740del n/a
11 ccsbBroad304_15781 pLX_304 0% 94.8% 94.8% V5 606_623del;696_740del n/a
12 TRCN0000471350 CTACCCCCTGCCACTTCGACGGAT pLX_317 44.8% 94.8% 94.8% V5 606_623del;696_740del n/a
Download CSV