Transcript: Human XM_011517966.3

PREDICTED: Homo sapiens myogenesis regulating glycosidase (putative) (MYORG), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MYORG (57462)
Length:
7013
CDS:
219..2363

Additional Resources:

NCBI RefSeq record:
XM_011517966.3
NBCI Gene record:
MYORG (57462)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011517966.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414425 ACCTCTATACCACCCATTAAG pLKO_005 2459 3UTR 100% 13.200 18.480 N MYORG n/a
2 TRCN0000157221 GCTACTTCAACAAGCCGTCAA pLKO.1 1114 CDS 100% 4.050 5.670 N MYORG n/a
3 TRCN0000421091 GACTTCGATGAGGTCAAATTC pLKO_005 1308 CDS 100% 13.200 9.240 N MYORG n/a
4 TRCN0000434780 TGGATGAGATCGCCTACTTTA pLKO_005 2329 CDS 100% 13.200 9.240 N MYORG n/a
5 TRCN0000157636 CCCATTCATCCTACCCGATAT pLKO.1 1856 CDS 100% 10.800 7.560 N MYORG n/a
6 TRCN0000152807 GCCATCATCATGTTCCCAATT pLKO.1 2971 3UTR 100% 10.800 7.560 N MYORG n/a
7 TRCN0000156466 CTTCTCCATCCGCAATCAGAA pLKO.1 515 CDS 100% 4.950 3.465 N MYORG n/a
8 TRCN0000156958 GCACTTCTTCATCCAGACTGT pLKO.1 647 CDS 100% 2.640 1.848 N MYORG n/a
9 TRCN0000149979 CCTAGAGATTTGTGGAACTTT pLKO.1 4606 3UTR 100% 5.625 2.813 Y UNC80 n/a
10 TRCN0000008902 CCTCCCAAAGTGTTGGGATTA pLKO.1 3716 3UTR 100% 1.080 0.540 Y GPR83 n/a
11 TRCN0000156315 CCTCCCAAAGTGTTGGGATTA pLKO.1 3716 3UTR 100% 1.080 0.540 Y MYORG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011517966.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08729 pDONR223 100% 99.9% 99.7% None 11A>T;159C>G n/a
2 ccsbBroad304_08729 pLX_304 0% 99.9% 99.7% V5 11A>T;159C>G n/a
3 TRCN0000481462 CAGCTTTTCTACTGCCAAGTCACG pLX_317 24.6% 99.9% 99.7% V5 11A>T;159C>G n/a
Download CSV