Transcript: Human NR_028074.2

Homo sapiens RAB2B, member RAS oncogene family (RAB2B), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
RAB2B (84932)
Length:
2870
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_028074.2
NBCI Gene record:
RAB2B (84932)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_028074.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000233287 AGCGGAACTCTCGTGACATAG pLKO_005 651 3UTR 100% 10.800 15.120 N RAB2B n/a
2 TRCN0000233285 CGACATTACAAGGCGTGAAAC pLKO_005 301 3UTR 100% 10.800 15.120 N RAB2B n/a
3 TRCN0000047856 GCTCGTATGGTCAACATTGAT pLKO.1 220 3UTR 100% 5.625 7.875 N RAB2B n/a
4 TRCN0000047855 GCAGCACTCTAGTTCCAACAT pLKO.1 358 3UTR 100% 4.950 6.930 N RAB2B n/a
5 TRCN0000047854 CCTCACAATAGGTGTGGAGTT pLKO.1 195 3UTR 100% 4.050 5.670 N RAB2B n/a
6 TRCN0000233288 GCCCTACTCTCCACTAATTAT pLKO_005 2110 3UTR 100% 15.000 12.000 N RAB2B n/a
7 TRCN0000233286 TAGGGAGCATGGACTTATATT pLKO_005 457 3UTR 100% 15.000 10.500 N RAB2B n/a
8 TRCN0000047857 GCTAGGGAGCATGGACTTATA pLKO.1 455 3UTR 100% 13.200 9.240 N RAB2B n/a
9 TRCN0000238813 GAGCTCGTATGGTCAACATTG pLKO_005 218 3UTR 100% 10.800 7.560 N RAB2B n/a
10 TRCN0000047853 GCCTTCATTAACACAGCCAAA pLKO.1 518 3UTR 100% 4.050 2.835 N RAB2B n/a
11 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 1472 3UTR 100% 4.950 2.475 Y n/a
12 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 1163 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_028074.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04448 pDONR223 100% 20.7% None 1_87del;272_273ins44;692_2870del n/a
2 ccsbBroad304_04448 pLX_304 0% 20.7% V5 1_87del;272_273ins44;692_2870del n/a
3 TRCN0000473242 CATTCCGAAGATATCCTACCCCCA pLX_317 55.3% 20.7% V5 1_87del;272_273ins44;692_2870del n/a
4 ccsbBroadEn_10275 pDONR223 100% 15.7% None 1_238del;692_2870del n/a
5 ccsbBroad304_10275 pLX_304 0% 15.7% V5 1_238del;692_2870del n/a
6 TRCN0000468323 TTTGACTGTAATAAATGTTTGGAG pLX_317 84.3% 15.7% V5 1_238del;692_2870del n/a
7 ccsbBroadEn_11616 pDONR223 100% 5.9% None (many diffs) n/a
8 ccsbBroad304_11616 pLX_304 0% 5.9% V5 (many diffs) n/a
9 TRCN0000467678 CCTCCCCTCACACCTCGTCAAAAC pLX_317 100% 5.9% V5 (many diffs) n/a
Download CSV