Transcript: Human XM_024447973.1

PREDICTED: Homo sapiens 5-hydroxytryptamine receptor 7 (HTR7), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HTR7 (3363)
Length:
4711
CDS:
77..922

Additional Resources:

NCBI RefSeq record:
XM_024447973.1
NBCI Gene record:
HTR7 (3363)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024447973.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000378339 CTGTTGTACACACTATCTTAT pLKO_005 1058 3UTR 100% 13.200 10.560 N HTR7 n/a
2 TRCN0000009124 CCAGGACTTTGGCTATACGAT pLKO.1 184 CDS 100% 3.000 2.400 N HTR7 n/a
3 TRCN0000357503 GAATCCAGTCATCAGCTAATA pLKO_005 1408 3UTR 100% 13.200 9.240 N HTR7 n/a
4 TRCN0000378275 TCACCTTACCTCCACTCTTTG pLKO_005 120 CDS 100% 10.800 7.560 N HTR7 n/a
5 TRCN0000009125 GTACCGGAATATCAACCGGAA pLKO.1 688 CDS 100% 0.000 0.000 N HTR7 n/a
6 TRCN0000357452 TACTCTACCGCAGTGGCATTT pLKO_005 206 CDS 100% 10.800 6.480 N HTR7 n/a
7 TRCN0000009123 GCTCAGAATGTAAATGATGAT pLKO.1 146 CDS 100% 4.950 2.970 N HTR7 n/a
8 TRCN0000027420 GCTATGCAAACTCTCTCATTA pLKO.1 600 CDS 100% 13.200 6.600 Y Htr7 n/a
9 TRCN0000009122 GCACACCAACAGAACTGAGTT pLKO.1 1165 3UTR 100% 4.950 2.475 Y HTR7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024447973.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00808 pDONR223 100% 51.5% 48.7% None 0_1ins594;702_799del;840_843delTGAT n/a
2 ccsbBroad304_00808 pLX_304 0% 51.5% 48.7% V5 0_1ins594;702_799del;840_843delTGAT n/a
3 TRCN0000488221 AACAACTTAGTTTTTTTGTTAAGT pLX_317 26.7% 48.8% 48.8% V5 (not translated due to prior stop codon) 0_1ins594;703_843del n/a
Download CSV