Transcript: Human NM_002093.4

Homo sapiens glycogen synthase kinase 3 beta (GSK3B), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
GSK3B (2932)
Length:
7782
CDS:
1014..2315

Additional Resources:

NCBI RefSeq record:
NM_002093.4
NBCI Gene record:
GSK3B (2932)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002093.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000197009 GATGAATTACGGGACCCAAAT pLKO.1 2073 CDS 100% 10.800 15.120 N GSK3B n/a
2 TRCN0000040000 GCAGGACAAGAGATTTAAGAA pLKO.1 1277 CDS 100% 5.625 7.875 N GSK3B n/a
3 TRCN0000010551 CACTGGTCACGTTTGGAAAGA pLKO.1 2377 3UTR 100% 4.950 6.930 N GSK3B n/a
4 TRCN0000000824 CCAATGTTTCGTATATCTGTT pLKO.1 1648 CDS 100% 4.950 6.930 N GSK3B n/a
5 TRCN0000039998 CCACTGATTATACCTCTAGTA pLKO.1 1705 CDS 100% 4.950 6.930 N GSK3B n/a
6 TRCN0000000823 CCGATTGCGTTATTTCTTCTA pLKO.1 1343 CDS 100% 4.950 6.930 N GSK3B n/a
7 TRCN0000039999 CCCAAACTACACAGAATTTAA pLKO.1 1868 CDS 100% 15.000 10.500 N GSK3B n/a
8 TRCN0000040002 GACACTAAAGTGATTGGAAAT pLKO.1 1185 CDS 100% 10.800 7.560 N GSK3B n/a
9 TRCN0000012617 CGGGACCCAAATGTCAAACTA pLKO.1 2082 CDS 100% 5.625 3.938 N Gsk3b n/a
10 TRCN0000294539 CGGGACCCAAATGTCAAACTA pLKO_005 2082 CDS 100% 5.625 3.938 N Gsk3b n/a
11 TRCN0000010552 GTGTGGATCAGTTGGTAGAAA pLKO.1 1798 CDS 100% 5.625 3.938 N GSK3B n/a
12 TRCN0000039564 CATGAAAGTTAGCAGAGACAA pLKO.1 1088 CDS 100% 4.950 3.465 N GSK3B n/a
13 TRCN0000012614 CCACTCAAGAACTGTCAAGTA pLKO.1 2140 CDS 100% 4.950 3.465 N Gsk3b n/a
14 TRCN0000294607 CCACTCAAGAACTGTCAAGTA pLKO_005 2140 CDS 100% 4.950 3.465 N Gsk3b n/a
15 TRCN0000000822 CCCAAATGTCAAACTACCAAA pLKO.1 2087 CDS 100% 4.950 3.465 N GSK3B n/a
16 TRCN0000040001 GCTGAGCTGTTACTAGGACAA pLKO.1 1755 CDS 100% 4.050 2.835 N GSK3B n/a
17 TRCN0000039565 AGCAAATCAGAGAAATGAAC pLKO.1 1849 CDS 100% 0.000 0.000 N GSK3B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002093.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488643 CATCTGATGGTGCTTGCACTGTTC pLX_317 28.3% 100% 100% V5 (not translated due to prior stop codon) n/a
2 TRCN0000488872 CTACAGCCTCCCTTGCTAACTTCC pLX_317 27.2% 99.9% 99.7% V5 1299_1300insG n/a
Download CSV