Transcript: Human NM_001365389.1

Homo sapiens olfactory receptor 4N4 (LOC105369274), mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
LOC105369274 (105369274)
Length:
1231
CDS:
81..1082

Additional Resources:

NCBI RefSeq record:
NM_001365389.1
NBCI Gene record:
LOC105369274 (105369274)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001365389.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000187852 GCACCACTCGTGTCATTATTA pLKO.1 850 CDS 100% 15.000 7.500 Y OR4N4 n/a
2 TRCN0000185740 GTCTTTGTGCTGATCTTAATT pLKO.1 210 CDS 100% 15.000 7.500 Y OR4N4 n/a
3 TRCN0000187195 CCTCTCTGAGAAGAAGGTAAT pLKO.1 386 CDS 100% 10.800 5.400 Y OR4N5 n/a
4 TRCN0000187495 GATGCATCCTACTCCTTCATT pLKO.1 339 CDS 100% 5.625 2.813 Y OR4N4 n/a
5 TRCN0000188464 CTGATGACACTCCTGTGCTTT pLKO.1 744 CDS 100% 4.950 2.475 Y OR4N4 n/a
6 TRCN0000204121 GCACTGTTCAACTGTCATGAA pLKO.1 521 CDS 100% 4.950 2.475 Y OR4N4 n/a
7 TRCN0000203536 GTGTGTTTGATTGCTCTGTTA pLKO.1 53 5UTR 100% 4.950 2.475 Y OR4M2 n/a
8 TRCN0000188833 GCTCTTGGTCTTTGTGCTGAT pLKO.1 203 CDS 100% 4.050 2.025 Y OR4N4 n/a
9 TRCN0000186868 GTCTCAAGATATTCAGCTCTT pLKO.1 188 CDS 100% 4.050 2.025 Y OR4N4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001365389.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09947 pDONR223 100% 94.6% 94.5% None 1_51del;438T>C;828A>G n/a
2 ccsbBroad304_09947 pLX_304 0% 94.6% 94.5% V5 1_51del;438T>C;828A>G n/a
3 TRCN0000475845 ACATCCATTCGCTTTCGACAGAAA pLX_317 30.3% 94.6% 94.5% V5 1_51del;438T>C;828A>G n/a
Download CSV