Transcript: Human XM_006715572.4

PREDICTED: Homo sapiens tubulin tyrosine ligase like 2 (TTLL2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TTLL2 (83887)
Length:
2762
CDS:
172..1731

Additional Resources:

NCBI RefSeq record:
XM_006715572.4
NBCI Gene record:
TTLL2 (83887)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006715572.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434585 ATGTGCTACACTACGATTATG pLKO_005 2006 3UTR 100% 13.200 18.480 N TTLL2 n/a
2 TRCN0000426876 GTGATTGGTCATGGTTGTAAA pLKO_005 895 CDS 100% 13.200 10.560 N TTLL2 n/a
3 TRCN0000048533 GCCTCTTATGAGAAGATCAAA pLKO.1 871 CDS 100% 5.625 4.500 N TTLL2 n/a
4 TRCN0000048535 CCTTTACTTATTGGCAGATAT pLKO.1 688 CDS 100% 13.200 9.240 N TTLL2 n/a
5 TRCN0000424527 TTAAGCCTTTGACCATTTATG pLKO_005 746 CDS 100% 13.200 9.240 N TTLL2 n/a
6 TRCN0000048536 CCACAAAGCAAGCCCAAGTTA pLKO.1 1465 CDS 100% 5.625 3.938 N TTLL2 n/a
7 TRCN0000048537 CCTCATTTGATGGCGGAAGAT pLKO.1 163 5UTR 100% 4.950 3.465 N TTLL2 n/a
8 TRCN0000048534 CCATGATATTATTGACCTGAT pLKO.1 1176 CDS 100% 4.050 2.835 N TTLL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006715572.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09128 pDONR223 100% 87.4% 87.5% None (many diffs) n/a
2 ccsbBroad304_09128 pLX_304 0% 87.4% 87.5% V5 (many diffs) n/a
3 TRCN0000478463 ATTCCTCCCTATGTAGTTTGACCC pLX_317 17.8% 87.4% 87.5% V5 (many diffs) n/a
4 ccsbBroadEn_16025 pDONR223 0% 87.4% 87.3% None (many diffs) n/a
5 ccsbBroad304_16025 pLX_304 0% 87.4% 87.3% V5 (many diffs) n/a
6 TRCN0000465900 ACCTAGCCAACGACGCGGATCGTT pLX_317 12.1% 87.4% 87.3% V5 (many diffs) n/a
Download CSV