Transcript: Human XM_011541775.3

PREDICTED: Homo sapiens protein kinase C zeta (PRKCZ), transcript variant X12, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PRKCZ (5590)
Length:
2291
CDS:
158..1408

Additional Resources:

NCBI RefSeq record:
XM_011541775.3
NBCI Gene record:
PRKCZ (5590)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011541775.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000001221 GCCTCCAGTAGACGACAAGAA pLKO.1 733 CDS 100% 4.950 6.930 N PRKCZ n/a
2 TRCN0000195238 CAGATGGAATTGCTTACATTT pLKO.1 783 CDS 100% 13.200 9.240 N PRKCZ n/a
3 TRCN0000274627 CTTCCAAGCCAAGCGCTTTAA pLKO_005 553 CDS 100% 13.200 9.240 N Prkcz n/a
4 TRCN0000199050 CTGCAGGACTTTGACCTAATC pLKO.1 902 CDS 100% 10.800 7.560 N PRKCZ n/a
5 TRCN0000001220 CTGGTGCGGTTGAAGAAGAAT pLKO.1 959 CDS 100% 5.625 3.938 N PRKCZ n/a
6 TRCN0000010114 CATGAAAGTGGTGAAGAAAGA pLKO.1 994 CDS 100% 4.950 3.465 N PRKCZ n/a
7 TRCN0000010113 ACCTAATCAGAGTCATCGGGC pLKO.1 915 CDS 100% 0.540 0.378 N PRKCZ n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011541775.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01284 pDONR223 100% 66.5% 56.3% None (many diffs) n/a
2 ccsbBroad304_01284 pLX_304 33.6% 66.5% 56.3% V5 (many diffs) n/a
3 TRCN0000468951 TCTAGCACTATCAGGCTTACCTCC pLX_317 19.9% 66.5% 56.3% V5 (many diffs) n/a
4 ccsbBroadEn_14796 pDONR223 0% 66.5% 56.3% None (many diffs) n/a
5 ccsbBroad304_14796 pLX_304 33.6% 66.5% 56.3% V5 (many diffs) n/a
6 TRCN0000471650 GCTGTAGTGTGCCCGCTGAGGCCT pLX_317 23.7% 66.5% 56.3% V5 (many diffs) n/a
7 TRCN0000488644 CACGCTAGCACGACATTCTTTGCC pLX_317 18.5% 66.5% 56.3% V5 (not translated due to prior stop codon) (many diffs) n/a
8 TRCN0000489003 GTAAATACAATCATGACTCATCGG pLX_317 20.2% 66.5% 56.3% V5 (not translated due to prior stop codon) (many diffs) n/a
9 TRCN0000489417 TCCGCGACTATAACAATCCGTGAA pLX_317 19.5% 66.4% 56.3% V5 (many diffs) n/a
Download CSV