Transcript: Human NM_138399.5

Homo sapiens transmembrane protein 44 (TMEM44), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
TMEM44 (93109)
Length:
2372
CDS:
205..1521

Additional Resources:

NCBI RefSeq record:
NM_138399.5
NBCI Gene record:
TMEM44 (93109)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_138399.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000140535 GCACTGGACCTCGCTATTATT pLKO.1 973 CDS 100% 15.000 21.000 N TMEM44 n/a
2 TRCN0000140835 GAAGTATTGGGAGGCCCTAAA pLKO.1 1380 CDS 100% 10.800 7.560 N TMEM44 n/a
3 TRCN0000142945 CCTAGCAGCTATTGACTTAGT pLKO.1 486 CDS 100% 4.950 3.465 N TMEM44 n/a
4 TRCN0000122558 CGCTGCTTCTCTATCTGAGAT pLKO.1 338 CDS 100% 4.950 3.465 N TMEM44 n/a
5 TRCN0000139163 CTGCAAGTCACTGAGGACAAT pLKO.1 1152 CDS 100% 4.950 3.465 N TMEM44 n/a
6 TRCN0000140613 GACAGCAATCAGTCGCTACAT pLKO.1 1173 CDS 100% 4.950 3.465 N TMEM44 n/a
7 TRCN0000143353 GTGTGTGATGAAGAGCAAGAT pLKO.1 1002 CDS 100% 4.950 3.465 N TMEM44 n/a
8 TRCN0000140460 GAAGACATTTCCCTCCATCCA pLKO.1 825 CDS 100% 2.640 1.848 N TMEM44 n/a
9 TRCN0000140715 GACAGCTCACAATCCAGGTTT pLKO.1 452 CDS 100% 4.950 2.475 Y TMEM44 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_138399.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16069 pDONR223 0% 90.1% 75.4% None (many diffs) n/a
2 ccsbBroad304_16069 pLX_304 0% 90.1% 75.4% V5 (many diffs) n/a
3 ccsbBroadEn_12991 pDONR223 100% 38.7% 38.7% None 1_804del;1174_1175insAGC n/a
4 ccsbBroad304_12991 pLX_304 0% 38.7% 38.7% V5 1_804del;1174_1175insAGC n/a
5 TRCN0000469850 CGTCTCGAGCCATGAACCATGAGG pLX_317 11.6% 38.7% 38.7% V5 1_804del;1174_1175insAGC n/a
Download CSV