Transcript: Human NM_001286792.2

Homo sapiens spermatogenesis associated 13 (SPATA13), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
SPATA13 (221178)
Length:
8606
CDS:
291..4310

Additional Resources:

NCBI RefSeq record:
NM_001286792.2
NBCI Gene record:
SPATA13 (221178)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001286792.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000186369 CGGTGATTACAGCAACATAAA pLKO.1 3554 CDS 100% 13.200 18.480 N SPATA13 n/a
2 TRCN0000363971 TTGCGCAGCTAGCCACTATTT pLKO_005 3187 CDS 100% 13.200 18.480 N Spata13 n/a
3 TRCN0000187777 GCATCCAACGTTTCTTCAGAT pLKO.1 2631 CDS 100% 4.950 3.960 N SPATA13 n/a
4 TRCN0000187684 CACGGTGATTACAGCAACATA pLKO.1 3552 CDS 100% 5.625 3.938 N SPATA13 n/a
5 TRCN0000188181 CCACAGACACTGTGAGAACAA pLKO.1 3041 CDS 100% 4.950 3.465 N SPATA13 n/a
6 TRCN0000186516 GCTCTTACTCTCTTCTGTAAT pLKO.1 4795 3UTR 100% 13.200 7.920 N SPATA13 n/a
7 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 5181 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001286792.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09869 pDONR223 100% 48.6% 48.6% None 1_2061del;2905C>N n/a
2 ccsbBroad304_09869 pLX_304 0% 48.6% 48.6% V5 1_2061del;2905C>N n/a
3 TRCN0000472801 GTTAGCTATAAGACTTGCTAATTA pLX_317 19.5% 48.6% 48.6% V5 1_2061del;2905C>N n/a
Download CSV