Transcript: Human XM_011523003.3

PREDICTED: Homo sapiens G protein subunit alpha o1 (GNAO1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GNAO1 (2775)
Length:
2505
CDS:
372..1310

Additional Resources:

NCBI RefSeq record:
XM_011523003.3
NBCI Gene record:
GNAO1 (2775)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011523003.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000445022 AGGACGTCACGGCCATCATTT pLKO_005 895 CDS 100% 13.200 9.240 N GNAO1 n/a
2 TRCN0000036487 CGCTCACCCAACAAAGAAATA pLKO.1 1182 CDS 100% 13.200 9.240 N GNAO1 n/a
3 TRCN0000036485 GCCTACATCCAAGCACAATTT pLKO.1 1149 CDS 100% 13.200 9.240 N GNAO1 n/a
4 TRCN0000435676 TTAGTTGAGTCTTCACATTTA pLKO_005 1500 3UTR 100% 13.200 9.240 N GNAO1 n/a
5 TRCN0000327952 TTGTGCCACAGACACGAATAA pLKO_005 1217 CDS 100% 13.200 9.240 N Gnao1 n/a
6 TRCN0000097755 CGGCTGTGTATTTCTGTAGAA pLKO.1 1462 3UTR 100% 4.950 3.465 N Gnao1 n/a
7 TRCN0000036486 GCTCTTCGACTCCATCTGTAA pLKO.1 992 CDS 100% 4.950 3.465 N GNAO1 n/a
8 TRCN0000036488 TGGGCATCGAATATGGTGATA pLKO.1 517 CDS 100% 4.950 3.465 N GNAO1 n/a
9 TRCN0000097757 CGCTCACCCAACAAAGAAATT pLKO.1 1182 CDS 100% 13.200 9.240 N Gnao1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011523003.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10852 pDONR223 100% 96.5% 96.1% None 1_30del;32G>T;35G>A n/a
2 ccsbBroad304_10852 pLX_304 0% 96.5% 96.1% V5 1_30del;32G>T;35G>A n/a
3 TRCN0000470559 CGCAGTCCCGCCTCCTCAACACCG pLX_317 39.9% 96.5% 96.1% V5 1_30del;32G>T;35G>A n/a
Download CSV